[English] 日本語
Yorodumi
- PDB-8vws: Nucleosome containing 8oxoG at SHL-6 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8vws
TitleNucleosome containing 8oxoG at SHL-6
Components
  • 601 I strand (non-damaged strand)
  • 601 J strand (damaged strand)
  • Histone H2A type 1
  • Histone H2B type 1-C/E/F/G/I
  • Histone H3.2
  • Histone H4
KeywordsDNA BINDING PROTEIN/DNA / Nucleosome / 8-oxo-guanine DNA Glycosylase I / DNA Repair / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Deposition of new CENPA-containing nucleosomes at the centromere / telomere organization ...negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Deposition of new CENPA-containing nucleosomes at the centromere / telomere organization / Interleukin-7 signaling / Recognition and association of DNA glycosylase with site containing an affected pyrimidine / Cleavage of the damaged pyrimidine / RNA Polymerase I Promoter Opening / Inhibition of DNA recombination at telomere / Assembly of the ORC complex at the origin of replication / Meiotic synapsis / SUMOylation of chromatin organization proteins / Regulation of endogenous retroelements by the Human Silencing Hub (HUSH) complex / DNA methylation / Condensation of Prophase Chromosomes / Chromatin modifications during the maternal to zygotic transition (MZT) / SIRT1 negatively regulates rRNA expression / HCMV Late Events / ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression / PRC2 methylates histones and DNA / innate immune response in mucosa / Regulation of endogenous retroelements by KRAB-ZFP proteins / Defective pyroptosis / HDACs deacetylate histones / Regulation of endogenous retroelements by Piwi-interacting RNAs (piRNAs) / Nonhomologous End-Joining (NHEJ) / RNA Polymerase I Promoter Escape / Transcriptional regulation by small RNAs / Formation of the beta-catenin:TCF transactivating complex / Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 / HDMs demethylate histones / RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function / G2/M DNA damage checkpoint / Negative Regulation of CDH1 Gene Transcription / NoRC negatively regulates rRNA expression / PKMTs methylate histone lysines / B-WICH complex positively regulates rRNA expression / DNA Damage/Telomere Stress Induced Senescence / Pre-NOTCH Transcription and Translation / Meiotic recombination / Activation of anterior HOX genes in hindbrain development during early embryogenesis / Metalloprotease DUBs / Transcriptional regulation of granulopoiesis / RMTs methylate histone arginines / HCMV Early Events / structural constituent of chromatin / UCH proteinases / nucleosome / antimicrobial humoral immune response mediated by antimicrobial peptide / heterochromatin formation / nucleosome assembly / E3 ubiquitin ligases ubiquitinate target proteins / Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks / antibacterial humoral response / HATs acetylate histones / Factors involved in megakaryocyte development and platelet production / RUNX1 regulates transcription of genes involved in differentiation of HSCs / MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis / chromatin organization / Processing of DNA double-strand break ends / Senescence-Associated Secretory Phenotype (SASP) / Oxidative Stress Induced Senescence / Estrogen-dependent gene expression / gene expression / chromosome, telomeric region / Ub-specific processing proteases / defense response to Gram-positive bacterium / Amyloid fiber formation / protein heterodimerization activity / chromatin binding / enzyme binding / negative regulation of transcription by RNA polymerase II / protein-containing complex / : / DNA binding / RNA binding / extracellular exosome / extracellular region / nucleoplasm / membrane / identical protein binding / nucleus / cytosol
Similarity search - Function
: / Histone H2A conserved site / Histone H2A signature. / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A ...: / Histone H2A conserved site / Histone H2A signature. / Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF), histone-like fold domain / Histone H4, conserved site / Histone H4 signature. / Histone H4 / Histone H4 / CENP-T/Histone H4, histone fold / Centromere kinetochore component CENP-T histone fold / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Histone H2A/H2B/H3 / Core histone H2A/H2B/H3/H4 domain / Histone-fold
Similarity search - Domain/homology
DNA / DNA (> 10) / DNA (> 100) / Histone H2A type 1 / Histone H4 / Histone H2B type 1-C/E/F/G/I / Histone H3.2
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.1 Å
AuthorsWeaver, T.M. / Ling, J.A. / Freudenthal, B.D.
Funding support United States, 2items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R35GM128562 United States
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)F32GM140718 United States
CitationJournal: Nat Commun / Year: 2024
Title: Contributing factors to the oxidation-induced mutational landscape in human cells.
Authors: Cameron Cordero / Kavi P M Mehta / Tyler M Weaver / Justin A Ling / Bret D Freudenthal / David Cortez / Steven A Roberts /
Abstract: 8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently ...8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently unknown. Here, we show DNA oxidation induces G > T substitutions and insertion/deletion (INDEL) mutations in human cells and cancers. Potassium bromate (KBrO)-induced 8-oxoGs occur with similar sequence preferences as their derived substitutions, indicating that the reactivity of specific oxidants dictates mutation sequence specificity. While 8-oxoG occurs uniformly across chromatin, 8-oxoG-induced mutations are elevated in compact genomic regions, within nucleosomes, and at inward facing guanines within strongly positioned nucleosomes. Cryo-electron microscopy structures of OGG1-nucleosome complexes indicate that these effects originate from OGG1's ability to flip outward positioned 8-oxoG lesions into the catalytic pocket while inward facing lesions are occluded by the histone octamer. Mutation spectra from human cells with DNA repair deficiencies reveals contributions of a DNA repair network limiting 8-oxoG mutagenesis, where OGG1- and MUTYH-mediated base excision repair is supplemented by the replication-associated factors Pol η and HMCES. Transcriptional asymmetry of KBrO-induced mutations in OGG1- and Pol η-deficient cells also demonstrates transcription-coupled repair can prevent 8-oxoG-induced mutation. Thus, oxidant chemistry, chromatin structures, and DNA repair processes combine to dictate the oxidative mutational landscape in human genomes.
History
DepositionFeb 2, 2024Deposition site: RCSB / Processing site: RCSB
Revision 1.0Oct 30, 2024Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 30, 2024Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Jan 15, 2025Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 1.2May 28, 2025Group: Data collection / Category: em_admin / em_software / Item: _em_admin.last_update / _em_software.name
Revision 1.1May 28, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Data processing / Experimental summary / Data content type: EM metadata / EM metadata / Category: em_admin / em_software / Data content type: EM metadata / EM metadata / Item: _em_admin.last_update / _em_software.name

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Histone H3.2
B: Histone H4
C: Histone H2A type 1
D: Histone H2B type 1-C/E/F/G/I
E: Histone H3.2
F: Histone H4
G: Histone H2A type 1
H: Histone H2B type 1-C/E/F/G/I
I: 601 I strand (non-damaged strand)
J: 601 J strand (damaged strand)


Theoretical massNumber of molelcules
Total (without water)199,40110
Polymers199,40110
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
Protein , 4 types, 8 molecules AEBFCGDH

#1: Protein Histone H3.2 / H3-clustered histone 13 / H3-clustered histone 14 / H3-clustered histone 15 / Histone H3/m / Histone H3/o


Mass: 15257.838 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human)
Gene: H3C15, HIST2H3A, H3C14, H3F2, H3FM, HIST2H3C, H3C13, HIST2H3D
Production host: Escherichia coli (E. coli) / References: UniProt: Q71DI3
#2: Protein Histone H4


Mass: 11263.231 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human)
Gene: H4C1, H4/A, H4FA, HIST1H4A, H4C2, H4/I, H4FI, HIST1H4B, H4C3, H4/G, H4FG, HIST1H4C, H4C4, H4/B, H4FB, HIST1H4D, H4C5, H4/J, H4FJ, HIST1H4E, H4C6, H4/C, H4FC, HIST1H4F, H4C8, H4/H, H4FH, ...Gene: H4C1, H4/A, H4FA, HIST1H4A, H4C2, H4/I, H4FI, HIST1H4B, H4C3, H4/G, H4FG, HIST1H4C, H4C4, H4/B, H4FB, HIST1H4D, H4C5, H4/J, H4FJ, HIST1H4E, H4C6, H4/C, H4FC, HIST1H4F, H4C8, H4/H, H4FH, HIST1H4H, H4C9, H4/M, H4FM, HIST1H4I, H4C11, H4/E, H4FE, HIST1H4J, H4C12, H4/D, H4FD, HIST1H4K, H4C13, H4/K, H4FK, HIST1H4L, H4C14, H4/N, H4F2, H4FN, HIST2H4, HIST2H4A, H4C15, H4/O, H4FO, HIST2H4B, H4-16, HIST4H4
Production host: Escherichia coli (E. coli) / References: UniProt: P62805
#3: Protein Histone H2A type 1 / H2A.1 / Histone H2A/ptl


Mass: 13990.342 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human)
Gene: H2AC11, H2AFP, HIST1H2AG, H2AC13, H2AFC, HIST1H2AI, H2AC15, H2AFD, HIST1H2AK, H2AC16, H2AFI, HIST1H2AL, H2AC17, H2AFN, HIST1H2AM
Production host: Escherichia coli (E. coli) / References: UniProt: P0C0S8
#4: Protein Histone H2B type 1-C/E/F/G/I / Histone H2B.1 A / Histone H2B.a / H2B/a / Histone H2B.g / H2B/g / Histone H2B.h / H2B/h / Histone ...Histone H2B.1 A / Histone H2B.a / H2B/a / Histone H2B.g / H2B/g / Histone H2B.h / H2B/h / Histone H2B.k / H2B/k / Histone H2B.l / H2B/l


Mass: 13806.018 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human)
Gene: H2BC4, H2BFL, HIST1H2BC, H2BC6, H2BFH, HIST1H2BE, H2BC7, H2BFG, HIST1H2BF, H2BC8, H2BFA, HIST1H2BG, H2BC10, H2BFK, HIST1H2BI
Production host: Escherichia coli (E. coli) / References: UniProt: P62807

-
DNA chain , 2 types, 2 molecules IJ

#5: DNA chain 601 I strand (non-damaged strand)


Mass: 45114.742 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: ATCGAGAATCCCGGT GCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACT CCC TAGTCT CCAGGCACGTGTCAGATCTATACATCCGAT
Source: (synth.) synthetic construct (others)
#6: DNA chain 601 J strand (damaged strand)


Mass: 45651.059 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
Details

Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Nucleosome containing 8oxoG at SHL-6 / Type: COMPLEX / Entity ID: all / Source: RECOMBINANT
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 7.1
Details: 50 mM HEPES (pH-7.1), 100 mM NaCl, 1 mM TCEP, and 1 mM EDTA
Buffer component
IDConc.NameFormulaBuffer-ID
150 mMN-2-hydroxyethylpiperazine-N-2-ethane sulfonic acidHEPES1
2100 mMSodium ChlorideNaCl1
31 mMTris (2-carboxyethyl) phosphine hydrochlorideTCEP-HCl1
41 mMEthylenediaminetetraacetic acidEDTA1
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 277.15 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm
Image recordingElectron dose: 60 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k)

-
Processing

EM software
IDNameVersionCategory
4cryoSPARCv4.3CTF correction
8PHENIXmodel refinement
10cryoSPARCv4.3initial Euler assignment
11cryoSPARCv4.3final Euler assignment
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 3.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 44646 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00412720
ELECTRON MICROSCOPYf_angle_d0.61918445
ELECTRON MICROSCOPYf_dihedral_angle_d28.3745232
ELECTRON MICROSCOPYf_chiral_restr0.0352101
ELECTRON MICROSCOPYf_plane_restr0.0051313

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more