[English] 日本語
Yorodumi
- EMDB-43595: Nucleosome containing 8oxoG at SHL-6 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: EMDB / ID: EMD-43595
TitleNucleosome containing 8oxoG at SHL-6
Map data
Sample
  • Complex: Nucleosome containing 8oxoG at SHL-6
    • Protein or peptide: Histone H3.2
    • Protein or peptide: Histone H4
    • Protein or peptide: Histone H2A type 1
    • Protein or peptide: Histone H2B type 1-C/E/F/G/I
    • DNA: 601 I strand (non-damaged strand)
    • DNA: 601 J strand (damaged strand)
KeywordsNucleosome / 8-oxo-guanine DNA Glycosylase I / DNA Repair / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Deposition of new CENPA-containing nucleosomes at the centromere / Recognition and association of DNA glycosylase with site containing an affected pyrimidine ...negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Deposition of new CENPA-containing nucleosomes at the centromere / Recognition and association of DNA glycosylase with site containing an affected pyrimidine / Cleavage of the damaged pyrimidine / telomere organization / Interleukin-7 signaling / Inhibition of DNA recombination at telomere / RNA Polymerase I Promoter Opening / Meiotic synapsis / Assembly of the ORC complex at the origin of replication / SUMOylation of chromatin organization proteins / Regulation of endogenous retroelements by the Human Silencing Hub (HUSH) complex / DNA methylation / Condensation of Prophase Chromosomes / Chromatin modifications during the maternal to zygotic transition (MZT) / SIRT1 negatively regulates rRNA expression / HCMV Late Events / innate immune response in mucosa / ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression / PRC2 methylates histones and DNA / Regulation of endogenous retroelements by KRAB-ZFP proteins / Defective pyroptosis / HDMs demethylate histones / Regulation of endogenous retroelements by Piwi-interacting RNAs (piRNAs) / HDACs deacetylate histones / RNA Polymerase I Promoter Escape / Nonhomologous End-Joining (NHEJ) / Transcriptional regulation by small RNAs / Formation of the beta-catenin:TCF transactivating complex / RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function / Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 / G2/M DNA damage checkpoint / Metalloprotease DUBs / NoRC negatively regulates rRNA expression / B-WICH complex positively regulates rRNA expression / DNA Damage/Telomere Stress Induced Senescence / PKMTs methylate histone lysines / Meiotic recombination / Pre-NOTCH Transcription and Translation / RMTs methylate histone arginines / Activation of anterior HOX genes in hindbrain development during early embryogenesis / Transcriptional regulation of granulopoiesis / UCH proteinases / HCMV Early Events / antimicrobial humoral immune response mediated by antimicrobial peptide / structural constituent of chromatin / antibacterial humoral response / E3 ubiquitin ligases ubiquitinate target proteins / Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks / nucleosome / heterochromatin formation / RUNX1 regulates transcription of genes involved in differentiation of HSCs / nucleosome assembly / Processing of DNA double-strand break ends / HATs acetylate histones / Senescence-Associated Secretory Phenotype (SASP) / Factors involved in megakaryocyte development and platelet production / chromatin organization / MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis / Oxidative Stress Induced Senescence / gene expression / Estrogen-dependent gene expression / chromosome, telomeric region / Ub-specific processing proteases / defense response to Gram-positive bacterium / Amyloid fiber formation / protein heterodimerization activity / chromatin binding / enzyme binding / negative regulation of transcription by RNA polymerase II / protein-containing complex / extracellular space / DNA binding / RNA binding / extracellular exosome / extracellular region / nucleoplasm / identical protein binding / nucleus / membrane / cytosol
Similarity search - Function
: / Histone H2B signature. / Histone H2A conserved site / Histone H2A signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A ...: / Histone H2B signature. / Histone H2A conserved site / Histone H2A signature. / Histone H2B / Histone H2B / Histone H2A, C-terminal domain / C-terminus of histone H2A / Histone 2A / Histone H2A / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF), histone-like fold domain / Histone H4, conserved site / Histone H4 signature. / Histone H4 / Histone H4 / CENP-T/Histone H4, histone fold / Centromere kinetochore component CENP-T histone fold / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Histone H2A/H2B/H3 / Core histone H2A/H2B/H3/H4 / Histone-fold
Similarity search - Domain/homology
Histone H2A type 1 / Histone H4 / Histone H2B type 1-C/E/F/G/I / Histone H3.2
Similarity search - Component
Biological speciesHomo sapiens (human) / synthetic construct (others)
Methodsingle particle reconstruction / cryo EM / Resolution: 3.1 Å
AuthorsWeaver TM / Ling JA / Freudenthal BD
Funding support United States, 2 items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R35GM128562 United States
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)F32GM140718 United States
CitationJournal: Nat Commun / Year: 2024
Title: Contributing factors to the oxidation-induced mutational landscape in human cells.
Authors: Cameron Cordero / Kavi P M Mehta / Tyler M Weaver / Justin A Ling / Bret D Freudenthal / David Cortez / Steven A Roberts /
Abstract: 8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently ...8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently unknown. Here, we show DNA oxidation induces G > T substitutions and insertion/deletion (INDEL) mutations in human cells and cancers. Potassium bromate (KBrO)-induced 8-oxoGs occur with similar sequence preferences as their derived substitutions, indicating that the reactivity of specific oxidants dictates mutation sequence specificity. While 8-oxoG occurs uniformly across chromatin, 8-oxoG-induced mutations are elevated in compact genomic regions, within nucleosomes, and at inward facing guanines within strongly positioned nucleosomes. Cryo-electron microscopy structures of OGG1-nucleosome complexes indicate that these effects originate from OGG1's ability to flip outward positioned 8-oxoG lesions into the catalytic pocket while inward facing lesions are occluded by the histone octamer. Mutation spectra from human cells with DNA repair deficiencies reveals contributions of a DNA repair network limiting 8-oxoG mutagenesis, where OGG1- and MUTYH-mediated base excision repair is supplemented by the replication-associated factors Pol η and HMCES. Transcriptional asymmetry of KBrO-induced mutations in OGG1- and Pol η-deficient cells also demonstrates transcription-coupled repair can prevent 8-oxoG-induced mutation. Thus, oxidant chemistry, chromatin structures, and DNA repair processes combine to dictate the oxidative mutational landscape in human genomes.
History
DepositionFeb 2, 2024-
Header (metadata) releaseOct 30, 2024-
Map releaseOct 30, 2024-
UpdateMay 28, 2025-
Current statusMay 28, 2025Processing site: RCSB / Status: Released

-
Structure visualization

Supplemental images

Downloads & links

-
Map

FileDownload / File: emd_43595.map.gz / Format: CCP4 / Size: 824 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES)
Projections & slices

Image control

Size
Brightness
Contrast
Others
AxesX (Sec.)Y (Row.)Z (Col.)
0.53 Å/pix.
x 600 pix.
= 320.4 Å
0.53 Å/pix.
x 600 pix.
= 320.4 Å
0.53 Å/pix.
x 600 pix.
= 320.4 Å

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider.

Voxel sizeX=Y=Z: 0.534 Å
Density
Contour LevelBy AUTHOR: 7.5
Minimum - Maximum-19.855362 - 42.716754999999999
Average (Standard dev.)0.000000000000898 (±1.0)
SymmetrySpace group: 1
Details

EMDB XML:

Map geometry
Axis orderZYX
Origin000
Dimensions600600600
Spacing600600600
CellA=B=C: 320.4 Å
α=β=γ: 90.0 °

-
Supplemental data

-
Half map: #2

Fileemd_43595_half_map_1.map
Projections & Slices
AxesZYX

Projections

Slices (1/2)
Density Histograms

-
Half map: #1

Fileemd_43595_half_map_2.map
Projections & Slices
AxesZYX

Projections

Slices (1/2)
Density Histograms

-
Sample components

-
Entire : Nucleosome containing 8oxoG at SHL-6

EntireName: Nucleosome containing 8oxoG at SHL-6
Components
  • Complex: Nucleosome containing 8oxoG at SHL-6
    • Protein or peptide: Histone H3.2
    • Protein or peptide: Histone H4
    • Protein or peptide: Histone H2A type 1
    • Protein or peptide: Histone H2B type 1-C/E/F/G/I
    • DNA: 601 I strand (non-damaged strand)
    • DNA: 601 J strand (damaged strand)

-
Supramolecule #1: Nucleosome containing 8oxoG at SHL-6

SupramoleculeName: Nucleosome containing 8oxoG at SHL-6 / type: complex / ID: 1 / Parent: 0 / Macromolecule list: all
Source (natural)Organism: Homo sapiens (human)

-
Macromolecule #1: Histone H3.2

MacromoleculeName: Histone H3.2 / type: protein_or_peptide / ID: 1 / Number of copies: 2 / Enantiomer: LEVO
Source (natural)Organism: Homo sapiens (human)
Molecular weightTheoretical: 15.257838 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli)
SequenceString:
ARTKQTARKS TGGKAPRKQL ATKAARKSAP ATGGVKKPHR YRPGTVALRE IRRYQKSTEL LIRKLPFQRL VREIAQDFKT DLRFQSSAV MALQEASEAY LVGLFEDTNL AAIHAKRVTI MPKDIQLARR IRGERA

UniProtKB: Histone H3.2

-
Macromolecule #2: Histone H4

MacromoleculeName: Histone H4 / type: protein_or_peptide / ID: 2 / Number of copies: 2 / Enantiomer: LEVO
Source (natural)Organism: Homo sapiens (human)
Molecular weightTheoretical: 11.263231 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli)
SequenceString:
SGRGKGGKGL GKGGAKRHRK VLRDNIQGIT KPAIRRLARR GGVKRISGLI YEETRGVLKV FLENVIRDAV TYTEHAKRKT VTAMDVVYA LKRQGRTLYG FGG

UniProtKB: Histone H4

-
Macromolecule #3: Histone H2A type 1

MacromoleculeName: Histone H2A type 1 / type: protein_or_peptide / ID: 3 / Number of copies: 2 / Enantiomer: LEVO
Source (natural)Organism: Homo sapiens (human)
Molecular weightTheoretical: 13.990342 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli)
SequenceString:
SGRGKQGGKA RAKAKTRSSR AGLQFPVGRV HRLLRKGNYA ERVGAGAPVY LAAVLEYLTA EILELAGNAA RDNKKTRIIP RHLQLAIRN DEELNKLLGK VTIAQGGVLP NIQAVLLPKK TESHHKAKGK

UniProtKB: Histone H2A type 1

-
Macromolecule #4: Histone H2B type 1-C/E/F/G/I

MacromoleculeName: Histone H2B type 1-C/E/F/G/I / type: protein_or_peptide / ID: 4 / Number of copies: 2 / Enantiomer: LEVO
Source (natural)Organism: Homo sapiens (human)
Molecular weightTheoretical: 13.806018 KDa
Recombinant expressionOrganism: Escherichia coli (E. coli)
SequenceString:
PEPAKSAPAP KKGSKKAVTK AQKKDGKKRK RSRKESYSVY VYKVLKQVHP DTGISSKAMG IMNSFVNDIF ERIAGEASRL AHYNKRSTI TSREIQTAVR LLLPGELAKH AVSEGTKAVT KYTSSK

UniProtKB: Histone H2B type 1-C/E/F/G/I

-
Macromolecule #5: 601 I strand (non-damaged strand)

MacromoleculeName: 601 I strand (non-damaged strand) / type: dna / ID: 5
Details: ATCGAGAATCCCGGT GCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACT CCC TAGTCT CCAGGCACGTGTCAGATCTATACATCCGAT
Number of copies: 1 / Classification: DNA
Source (natural)Organism: synthetic construct (others)
Molecular weightTheoretical: 45.114742 KDa
SequenceString: (DA)(DT)(DC)(DG)(DA)(DG)(DA)(DA)(DT)(DC) (DC)(DC)(DG)(DG)(DT)(DG)(DC)(DC)(DG)(DA) (DG)(DG)(DC)(DC)(DG)(DC)(DT)(DC)(DA) (DA)(DT)(DT)(DG)(DG)(DT)(DC)(DG)(DT)(DA) (DG) (DA)(DC)(DA)(DG)(DC)(DT) ...String:
(DA)(DT)(DC)(DG)(DA)(DG)(DA)(DA)(DT)(DC) (DC)(DC)(DG)(DG)(DT)(DG)(DC)(DC)(DG)(DA) (DG)(DG)(DC)(DC)(DG)(DC)(DT)(DC)(DA) (DA)(DT)(DT)(DG)(DG)(DT)(DC)(DG)(DT)(DA) (DG) (DA)(DC)(DA)(DG)(DC)(DT)(DC)(DT) (DA)(DG)(DC)(DA)(DC)(DC)(DG)(DC)(DT)(DT) (DA)(DA) (DA)(DC)(DG)(DC)(DA)(DC)(DG) (DT)(DA)(DC)(DG)(DC)(DG)(DC)(DT)(DG)(DT) (DC)(DC)(DC) (DC)(DC)(DG)(DC)(DG)(DT) (DT)(DT)(DT)(DA)(DA)(DC)(DC)(DG)(DC)(DC) (DA)(DA)(DG)(DG) (DG)(DG)(DA)(DT)(DT) (DA)(DC)(DT)(DC)(DC)(DC)(DT)(DA)(DG)(DT) (DC)(DT)(DC)(DC)(DA) (DG)(DG)(DC)(DA) (DC)(DG)(DT)(DG)(DT)(DC)(DA)(DG)(DA)(DT) (DC)(DT)(DA)(DT)(DA)(DC) (DA)(DT)(DC) (DC)(DG)(DA)(DT)

-
Macromolecule #6: 601 J strand (damaged strand)

MacromoleculeName: 601 J strand (damaged strand) / type: dna / ID: 6 / Number of copies: 1 / Classification: DNA
Source (natural)Organism: synthetic construct (others)
Molecular weightTheoretical: 45.651059 KDa
SequenceString: (DA)(DT)(DC)(DG)(DG)(DA)(DT)(DG)(DT)(DA) (DT)(DA)(8OG)(DA)(DT)(DC)(DT)(DG)(DA) (DC)(DA)(DC)(DG)(DT)(DG)(DC)(DC)(DT)(DG) (DG)(DA)(DG)(DA)(DC)(DT)(DA)(DG)(DG)(DG) (DA)(DG)(DT)(DA)(DA)(DT)(DC) ...String:
(DA)(DT)(DC)(DG)(DG)(DA)(DT)(DG)(DT)(DA) (DT)(DA)(8OG)(DA)(DT)(DC)(DT)(DG)(DA) (DC)(DA)(DC)(DG)(DT)(DG)(DC)(DC)(DT)(DG) (DG)(DA)(DG)(DA)(DC)(DT)(DA)(DG)(DG)(DG) (DA)(DG)(DT)(DA)(DA)(DT)(DC)(DC)(DC) (DC)(DT)(DT)(DG)(DG)(DC)(DG)(DG)(DT)(DT) (DA) (DA)(DA)(DA)(DC)(DG)(DC)(DG)(DG) (DG)(DG)(DG)(DA)(DC)(DA)(DG)(DC)(DG)(DC) (DG)(DT) (DA)(DC)(DG)(DT)(DG)(DC)(DG) (DT)(DT)(DT)(DA)(DA)(DG)(DC)(DG)(DG)(DT) (DG)(DC)(DT) (DA)(DG)(DA)(DG)(DC)(DT) (DG)(DT)(DC)(DT)(DA)(DC)(DG)(DA)(DC)(DC) (DA)(DA)(DT)(DT) (DG)(DA)(DG)(DC)(DG) (DG)(DC)(DC)(DT)(DC)(DG)(DG)(DC)(DA)(DC) (DC)(DG)(DG)(DG)(DA) (DT)(DT)(DC)(DT) (DC)(DG)(DA)(DT)

-
Experimental details

-
Structure determination

Methodcryo EM
Processingsingle particle reconstruction
Aggregation stateparticle

-
Sample preparation

BufferpH: 7.1
Component:
ConcentrationFormulaName
50.0 mMHEPESN-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid
100.0 mMNaClSodium Chloride
1.0 mMTCEP-HClTris (2-carboxyethyl) phosphine hydrochloride
1.0 mMEDTAEthylenediaminetetraacetic acid

Details: 50 mM HEPES (pH-7.1), 100 mM NaCl, 1 mM TCEP, and 1 mM EDTA
VitrificationCryogen name: ETHANE / Chamber humidity: 95 % / Chamber temperature: 277.15 K

-
Electron microscopy

MicroscopeFEI TITAN KRIOS
Image recordingFilm or detector model: GATAN K3 BIOQUANTUM (6k x 4k) / Average electron dose: 60.0 e/Å2
Electron beamAcceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
Electron opticsIllumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Nominal defocus max: 2.5 µm / Nominal defocus min: 0.5 µm
Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company

+
Image processing

CTF correctionSoftware - Name: cryoSPARC (ver. v4.3) / Type: PHASE FLIPPING AND AMPLITUDE CORRECTION
Startup modelType of model: PDB ENTRY
PDB model - PDB ID:
Final reconstructionResolution.type: BY AUTHOR / Resolution: 3.1 Å / Resolution method: FSC 0.143 CUT-OFF / Number images used: 44646
Initial angle assignmentType: MAXIMUM LIKELIHOOD / Software - Name: cryoSPARC (ver. v4.3)
Final angle assignmentType: MAXIMUM LIKELIHOOD / Software - Name: cryoSPARC (ver. v4.3)

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more