[English] 日本語

- PDB-8rq2: Escherichia coli 50S subunit in complex with the antimicrobial pe... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 8rq2 | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Title | Escherichia coli 50S subunit in complex with the antimicrobial peptide Api88 - conformation III | ||||||||||||||||||
![]() |
| ||||||||||||||||||
![]() | RIBOSOME / antimicrobial peptide / RNA / ribosomal protein / PrAMP / proline-rich peptide / antibiotics / 50S / Api88 | ||||||||||||||||||
Function / homology | ![]() negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / mRNA regulatory element binding translation repressor activity ...negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / mRNA regulatory element binding translation repressor activity / assembly of large subunit precursor of preribosome / ribosome assembly / cytosolic ribosome assembly / response to reactive oxygen species / translational initiation / regulation of cell growth / DNA-templated transcription termination / response to radiation / mRNA 5'-UTR binding / large ribosomal subunit / transferase activity / ribosome binding / 5S rRNA binding / ribosomal large subunit assembly / large ribosomal subunit rRNA binding / cytosolic large ribosomal subunit / cytoplasmic translation / tRNA binding / negative regulation of translation / rRNA binding / structural constituent of ribosome / ribosome / translation / response to antibiotic / negative regulation of DNA-templated transcription / mRNA binding / DNA binding / RNA binding / zinc ion binding / cytosol / cytoplasm Similarity search - Function | ||||||||||||||||||
Biological species | ![]() ![]() ![]() ![]() | ||||||||||||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.44 Å | ||||||||||||||||||
![]() | Lauer, S. / Nikolay, R. / Spahn, C. | ||||||||||||||||||
Funding support | ![]()
| ||||||||||||||||||
![]() | ![]() Title: Multimodal binding and inhibition of bacterial ribosomes by the antimicrobial peptides Api137 and Api88. Authors: Simon M Lauer / Maren Reepmeyer / Ole Berendes / Dorota Klepacki / Jakob Gasse / Sara Gabrielli / Helmut Grubmüller / Lars V Bock / Andor Krizsan / Rainer Nikolay / Christian M T Spahn / Ralf Hoffmann / ![]() ![]() Abstract: Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized ...Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized derivative of honeybee PrAMP apidaecin, inhibits protein expression by trapping release factors (RFs), which interact with stop codons on ribosomes to terminate translation. This study uses cryo-EM, functional assays and molecular dynamic (MD) simulations to show that Api137 additionally occupies a second binding site near the exit of the PET and can repress translation independently of RF-trapping. Api88, a C-terminally amidated (-CONH) analog of Api137 (-COOH), binds to the same sites, occupies a third binding pocket and interferes with the translation process presumably without RF-trapping. In conclusion, apidaecin-derived PrAMPs inhibit bacterial ribosomes by multimodal mechanisms caused by minor structural changes and thus represent a promising pool for drug development efforts. | ||||||||||||||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 2.2 MB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 1.7 MB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.6 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.6 MB | Display | |
Data in XML | ![]() | 125.1 KB | Display | |
Data in CIF | ![]() | 225.5 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 19429MC ![]() 8rpyC ![]() 8rpzC ![]() 8rq0C M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
+Large ribosomal subunit protein ... , 29 types, 29 molecules 012346CDEFGHJKLMNOPQRSTUVWXYZ
-RNA chain , 2 types, 2 molecules AB
#7: RNA chain | Mass: 941321.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) ![]() ![]() |
---|---|
#8: RNA chain | Mass: 38813.133 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGU GUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAA Source: (natural) ![]() ![]() |
-Protein/peptide , 1 types, 3 molecules xyz
#32: Protein/peptide | Mass: 2082.460 Da / Num. of mol.: 3 / Source method: obtained synthetically / Source: (synth.) ![]() ![]() |
---|
-Details
Has ligand of interest | Y |
---|---|
Has protein modification | Y |
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Experimental value: NO | ||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||
Source (recombinant) | Organism: synthetic construct (others) | ||||||||||||||||||||||||
Buffer solution | pH: 7.6 | ||||||||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
Specimen support | Grid material: COPPER / Grid mesh size: 400 divisions/in. / Grid type: Quantifoil R2/2 | ||||||||||||||||||||||||
Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: TFS KRIOS |
Electron gun | Electron source: ![]() |
Electron lens | Mode: OTHER / Nominal defocus max: 2000 nm / Nominal defocus min: 500 nm |
Image recording | Electron dose: 26 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) |
-
Processing
EM software |
| ||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||||||
3D reconstruction | Resolution: 2.44 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 260475 / Symmetry type: POINT | ||||||||||||||||||||||||||||||||
Atomic model building | Space: REAL | ||||||||||||||||||||||||||||||||
Refine LS restraints |
|