[English] 日本語
Yorodumi
- PDB-8rq2: Escherichia coli 50S subunit in complex with the antimicrobial pe... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8rq2
TitleEscherichia coli 50S subunit in complex with the antimicrobial peptide Api88 - conformation III
Components
  • (Large ribosomal subunit protein ...) x 29
  • 23S ribosomal RNA
  • 5S ribosomal RNA
  • Apidaecins type 88
KeywordsRIBOSOME / antimicrobial peptide / RNA / ribosomal protein / PrAMP / proline-rich peptide / antibiotics / 50S / Api88
Function / homology
Function and homology information


negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / mRNA regulatory element binding translation repressor activity ...negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / mRNA regulatory element binding translation repressor activity / assembly of large subunit precursor of preribosome / ribosome assembly / cytosolic ribosome assembly / response to reactive oxygen species / translational initiation / regulation of cell growth / DNA-templated transcription termination / response to radiation / mRNA 5'-UTR binding / large ribosomal subunit / transferase activity / ribosome binding / 5S rRNA binding / ribosomal large subunit assembly / large ribosomal subunit rRNA binding / cytosolic large ribosomal subunit / cytoplasmic translation / tRNA binding / negative regulation of translation / rRNA binding / structural constituent of ribosome / ribosome / translation / response to antibiotic / negative regulation of DNA-templated transcription / mRNA binding / DNA binding / RNA binding / zinc ion binding / cytosol / cytoplasm
Similarity search - Function
Ribosomal protein L25, short-form / Ribosomal protein L31 type A / Ribosomal protein L31 signature. / Ribosomal protein L31 / Ribosomal protein L31 superfamily / Ribosomal protein L31 / Ribosomal protein L16 signature 1. / Ribosomal protein L21, conserved site / Ribosomal protein L21 signature. / Ribosomal protein L16 signature 2. ...Ribosomal protein L25, short-form / Ribosomal protein L31 type A / Ribosomal protein L31 signature. / Ribosomal protein L31 / Ribosomal protein L31 superfamily / Ribosomal protein L31 / Ribosomal protein L16 signature 1. / Ribosomal protein L21, conserved site / Ribosomal protein L21 signature. / Ribosomal protein L16 signature 2. / Ribosomal protein L16, conserved site / Ribosomal protein L6, conserved site / Ribosomal protein L6 signature 1. / : / Ribosomal protein L9 signature. / Ribosomal protein L9, bacteria/chloroplast / Ribosomal protein L9, C-terminal / Ribosomal protein L9, C-terminal domain / Ribosomal protein L9, C-terminal domain superfamily / Ribosomal protein L17 signature. / Ribosomal L25p family / Ribosomal protein L25 / Ribosomal protein L36 signature. / Ribosomal protein L32p, bacterial type / Ribosomal protein L28/L24 superfamily / Ribosomal protein L25/Gln-tRNA synthetase, N-terminal / Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain superfamily / : / Ribosomal protein L9, N-terminal domain superfamily / Ribosomal protein L9 / Ribosomal protein L9, N-terminal / Ribosomal protein L9, N-terminal domain / Ribosomal protein L33, conserved site / Ribosomal protein L33 signature. / Ribosomal protein L35, conserved site / Ribosomal protein L35 signature. / Ribosomal protein L28 / Ribosomal protein L35, non-mitochondrial / Ribosomal protein L18, bacterial-type / : / Ribosomal protein L6, bacterial-type / Ribosomal protein L9/RNase H1, N-terminal / Ribosomal protein L5, bacterial-type / Ribosomal protein L36 / Ribosomal protein L36 superfamily / Ribosomal protein L36 / Ribosomal protein L19, conserved site / Ribosomal protein L19 signature. / Ribosomal protein L27, conserved site / Ribosomal protein L27 signature. / Ribosomal protein L20 signature. / Ribosomal protein L22, bacterial/chloroplast-type / Ribosomal protein L14P, bacterial-type / Ribosomal protein L34, conserved site / Ribosomal protein L34 signature. / Ribosomal protein L2, bacterial/organellar-type / Ribosomal protein L35 / Ribosomal protein L35 superfamily / Ribosomal protein L35 / Ribosomal protein L33 / Ribosomal protein L18 / Ribosomal L18 of archaea, bacteria, mitoch. and chloroplast / Ribosomal protein L33 / Ribosomal L28 family / Ribosomal protein L33 superfamily / Ribosomal protein L16 / Ribosomal protein L28/L24 / Ribosomal protein L30, bacterial-type / : / L28p-like / Ribosomal protein L27 / Ribosomal L27 protein / Ribosomal protein L20 / Ribosomal L32p protein family / Ribosomal protein L19 / Ribosomal protein L19 / Ribosomal protein L20 / Ribosomal protein L20, C-terminal / Ribosomal protein L19 superfamily / Ribosomal protein L21 / Ribosomal protein L32p / Ribosomal protein L17 / Ribosomal protein L17 superfamily / Ribosomal protein L17 / Ribosomal proteins 50S L24/mitochondrial 39S L24 / Ribosomal protein L21-like / L21-like superfamily / Ribosomal prokaryotic L21 protein / Ribosomal protein L34 / Ribosomal protein L34 / Ribosomal protein L24 / Ribosomal protein L3, bacterial/organelle-type / Ribosomal protein L15, bacterial-type / 50S ribosomal protein uL4 / Ribosomal protein L13, bacterial-type / Ribosomal protein L23/L25, conserved site / Ribosomal protein L23 signature. / Ribosomal protein L30, conserved site / Ribosomal protein L30 signature. / Ribosomal protein L5, conserved site
Similarity search - Domain/homology
RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Large ribosomal subunit protein uL15 / Large ribosomal subunit protein bL19 / Large ribosomal subunit protein bL20 / Large ribosomal subunit protein bL27 / Large ribosomal subunit protein bL28 / Large ribosomal subunit protein uL29 ...RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Large ribosomal subunit protein uL15 / Large ribosomal subunit protein bL19 / Large ribosomal subunit protein bL20 / Large ribosomal subunit protein bL27 / Large ribosomal subunit protein bL28 / Large ribosomal subunit protein uL29 / Large ribosomal subunit protein bL31 / Large ribosomal subunit protein bL32 / Large ribosomal subunit protein bL33 / Large ribosomal subunit protein bL34 / Large ribosomal subunit protein bL35 / Large ribosomal subunit protein bL36A / Large ribosomal subunit protein bL9 / Large ribosomal subunit protein uL13 / Large ribosomal subunit protein uL14 / Large ribosomal subunit protein uL16 / Large ribosomal subunit protein uL23 / Large ribosomal subunit protein bL17 / Large ribosomal subunit protein bL21 / Large ribosomal subunit protein uL30 / Large ribosomal subunit protein uL6 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein uL2 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein uL24 / Large ribosomal subunit protein uL4 / Large ribosomal subunit protein uL22 / Large ribosomal subunit protein uL5 / Large ribosomal subunit protein bL25
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
Apis mellifera (honey bee)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.44 Å
AuthorsLauer, S. / Nikolay, R. / Spahn, C.
Funding support Germany, 5items
OrganizationGrant numberCountry
German Federal Ministry for Education and Research16GW0300 Germany
German Research Foundation (DFG)INST 335/588-1 FUGG Germany
German Research Foundation (DFG)EXC 2008/1-390540038 Germany
German Federal Ministry for Education and Research16GW0299K Germany
German Research Foundation (DFG)EXC 2067/1-390729940 Germany
CitationJournal: Nat Commun / Year: 2024
Title: Multimodal binding and inhibition of bacterial ribosomes by the antimicrobial peptides Api137 and Api88.
Authors: Simon M Lauer / Maren Reepmeyer / Ole Berendes / Dorota Klepacki / Jakob Gasse / Sara Gabrielli / Helmut Grubmüller / Lars V Bock / Andor Krizsan / Rainer Nikolay / Christian M T Spahn / Ralf Hoffmann /
Abstract: Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized ...Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized derivative of honeybee PrAMP apidaecin, inhibits protein expression by trapping release factors (RFs), which interact with stop codons on ribosomes to terminate translation. This study uses cryo-EM, functional assays and molecular dynamic (MD) simulations to show that Api137 additionally occupies a second binding site near the exit of the PET and can repress translation independently of RF-trapping. Api88, a C-terminally amidated (-CONH) analog of Api137 (-COOH), binds to the same sites, occupies a third binding pocket and interferes with the translation process presumably without RF-trapping. In conclusion, apidaecin-derived PrAMPs inhibit bacterial ribosomes by multimodal mechanisms caused by minor structural changes and thus represent a promising pool for drug development efforts.
History
DepositionJan 17, 2024Deposition site: PDBE / Processing site: PDBE
Revision 1.0May 22, 2024Provider: repository / Type: Initial release
Revision 1.1Oct 9, 2024Group: Data collection / Structure summary
Category: em_admin / pdbx_entry_details / pdbx_modification_feature
Item: _em_admin.last_update / _pdbx_entry_details.has_protein_modification

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
0: Large ribosomal subunit protein bL32
1: Large ribosomal subunit protein bL33
2: Large ribosomal subunit protein bL34
3: Large ribosomal subunit protein bL35
4: Large ribosomal subunit protein bL36A
6: Large ribosomal subunit protein bL31
A: 23S ribosomal RNA
B: 5S ribosomal RNA
C: Large ribosomal subunit protein uL2
D: Large ribosomal subunit protein uL3
E: Large ribosomal subunit protein uL4
F: Large ribosomal subunit protein uL5
G: Large ribosomal subunit protein uL6
H: Large ribosomal subunit protein bL9
J: Large ribosomal subunit protein uL13
K: Large ribosomal subunit protein uL14
L: Large ribosomal subunit protein uL15
M: Large ribosomal subunit protein uL16
N: Large ribosomal subunit protein bL17
O: Large ribosomal subunit protein uL18
P: Large ribosomal subunit protein bL19
Q: Large ribosomal subunit protein bL20
R: Large ribosomal subunit protein bL21
S: Large ribosomal subunit protein uL22
T: Large ribosomal subunit protein uL23
U: Large ribosomal subunit protein uL24
V: Large ribosomal subunit protein bL25
W: Large ribosomal subunit protein bL27
X: Large ribosomal subunit protein bL28
Y: Large ribosomal subunit protein uL29
Z: Large ribosomal subunit protein uL30
x: Apidaecins type 88
y: Apidaecins type 88
z: Apidaecins type 88


Theoretical massNumber of molelcules
Total (without water)1,351,19034
Polymers1,351,19034
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

+
Large ribosomal subunit protein ... , 29 types, 29 molecules 012346CDEFGHJKLMNOPQRSTUVWXYZ

#1: Protein Large ribosomal subunit protein bL32 / 50S ribosomal protein L32


Mass: 6332.249 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7N4
#2: Protein/peptide Large ribosomal subunit protein bL33 / 50S ribosomal protein L33


Mass: 5814.842 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7N9
#3: Protein/peptide Large ribosomal subunit protein bL34 / 50S ribosomal protein L34


Mass: 5397.463 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7P5
#4: Protein Large ribosomal subunit protein bL35 / 50S ribosomal protein L35 / Ribosomal protein A


Mass: 7181.835 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7Q1
#5: Protein/peptide Large ribosomal subunit protein bL36A / 50S ribosomal protein L36 / Ribosomal protein B


Mass: 4377.390 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7Q6
#6: Protein Large ribosomal subunit protein bL31 / 50S ribosomal protein L31


Mass: 7516.693 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7M9
#9: Protein Large ribosomal subunit protein uL2 / 50S ribosomal protein L2


Mass: 29663.244 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P60422
#10: Protein Large ribosomal subunit protein uL3 / 50S ribosomal protein L3


Mass: 22277.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P60438
#11: Protein Large ribosomal subunit protein uL4 / 50S ribosomal protein L4


Mass: 22121.566 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P60723
#12: Protein Large ribosomal subunit protein uL5 / 50S ribosomal protein L5


Mass: 20073.234 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P62399
#13: Protein Large ribosomal subunit protein uL6 / 50S ribosomal protein L6


Mass: 18801.598 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0AG55
#14: Protein Large ribosomal subunit protein bL9 / 50S ribosomal protein L9


Mass: 15789.020 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7R1
#15: Protein Large ribosomal subunit protein uL13 / 50S ribosomal protein L13


Mass: 16050.606 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0AA10
#16: Protein Large ribosomal subunit protein uL14 / 50S ribosomal protein L14


Mass: 13451.910 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0ADY3
#17: Protein Large ribosomal subunit protein uL15 / 50S ribosomal protein L15


Mass: 14877.273 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P02413
#18: Protein Large ribosomal subunit protein uL16 / 50S ribosomal protein L16


Mass: 15312.269 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0ADY7
#19: Protein Large ribosomal subunit protein bL17 / 50S ribosomal protein L17


Mass: 13721.938 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0AG44
#20: Protein Large ribosomal subunit protein uL18 / 50S ribosomal protein L18


Mass: 12663.471 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0C018
#21: Protein Large ribosomal subunit protein bL19 / 50S ribosomal protein L19


Mass: 13028.082 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7K6
#22: Protein Large ribosomal subunit protein bL20 / 50S ribosomal protein L20


Mass: 13396.828 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7L3
#23: Protein Large ribosomal subunit protein bL21 / 50S ribosomal protein L21


Mass: 11586.374 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0AG48
#24: Protein Large ribosomal subunit protein uL22 / 50S ribosomal protein L22


Mass: 12253.359 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P61175
#25: Protein Large ribosomal subunit protein uL23 / 50S ribosomal protein L23


Mass: 10546.472 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0ADZ0
#26: Protein Large ribosomal subunit protein uL24 / 50S ribosomal protein L24


Mass: 11078.874 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P60624
#27: Protein Large ribosomal subunit protein bL25 / 50S ribosomal protein L25


Mass: 10713.465 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P68919
#28: Protein Large ribosomal subunit protein bL27 / 50S ribosomal protein L27


Mass: 8174.394 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7L8
#29: Protein Large ribosomal subunit protein bL28 / 50S ribosomal protein L28


Mass: 8896.354 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7M2
#30: Protein Large ribosomal subunit protein uL29 / 50S ribosomal protein L29


Mass: 7286.464 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0A7M6
#31: Protein Large ribosomal subunit protein uL30 / 50S ribosomal protein L30


Mass: 6423.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) / References: UniProt: P0AG51

-
RNA chain , 2 types, 2 molecules AB

#7: RNA chain 23S ribosomal RNA


Mass: 941321.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli)
#8: RNA chain 5S ribosomal RNA


Mass: 38813.133 Da / Num. of mol.: 1 / Source method: isolated from a natural source
Details: UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGU GUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAA
Source: (natural) Escherichia coli (E. coli)

-
Protein/peptide , 1 types, 3 molecules xyz

#32: Protein/peptide Apidaecins type 88 / Api88


Mass: 2082.460 Da / Num. of mol.: 3 / Source method: obtained synthetically / Source: (synth.) Apis mellifera (honey bee)

-
Details

Has ligand of interestY
Has protein modificationY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1Api88 in complex with the large ribosomal subunit - conformation IIIRIBOSOMEall0MULTIPLE SOURCES
2Large ribosomal subunitRIBOSOME#1-#311NATURAL
3Api88COMPLEX#321RECOMBINANT
Molecular weightExperimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
22Escherichia coli (E. coli)562
33Apis mellifera (honey bee)7460
Source (recombinant)Organism: synthetic construct (others)
Buffer solutionpH: 7.6
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid mesh size: 400 divisions/in. / Grid type: Quantifoil R2/2
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: OTHER
Electron lensMode: OTHER / Nominal defocus max: 2000 nm / Nominal defocus min: 500 nm
Image recordingElectron dose: 26 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k)

-
Processing

EM software
IDNameVersionCategory
1Warpparticle selection
4WarpCTF correction
7Coot0.9.8model fitting
9PHENIX1.20_4459:model refinement
11cryoSPARC4.21final Euler assignment
12RELION3.1classification
13cryoSPARC4.23D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 2.44 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 260475 / Symmetry type: POINT
Atomic model buildingSpace: REAL
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00298805
ELECTRON MICROSCOPYf_angle_d0.364148408
ELECTRON MICROSCOPYf_dihedral_angle_d12.59439917
ELECTRON MICROSCOPYf_chiral_restr0.03119035
ELECTRON MICROSCOPYf_plane_restr0.0037554

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more