[English] 日本語
Yorodumi
- PDB-8rcf: RAD51 nucleoprotein filament on double-stranded abasic DNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8rcf
TitleRAD51 nucleoprotein filament on double-stranded abasic DNA
Components
  • DNA (5'-D(P*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*A)-3')
  • DNA (5'-D(P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*G)-3')
  • DNA repair protein RAD51 homolog 1
KeywordsDNA BINDING PROTEIN / Homologous recombination / DNA replication / abasic DNA
Function / homology
Function and homology information


presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / cellular response to cisplatin / nuclear ubiquitin ligase complex / DNA strand invasion ...presynaptic intermediate filament cytoskeleton / response to glucoside / mitotic recombination-dependent replication fork processing / DNA recombinase assembly / chromosome organization involved in meiotic cell cycle / telomere maintenance via telomere lengthening / double-strand break repair involved in meiotic recombination / cellular response to cisplatin / nuclear ubiquitin ligase complex / DNA strand invasion / mitotic recombination / cellular response to hydroxyurea / cellular response to camptothecin / replication-born double-strand break repair via sister chromatid exchange / lateral element / DNA strand exchange activity / Impaired BRCA2 binding to PALB2 / regulation of DNA damage checkpoint / telomere maintenance via recombination / reciprocal meiotic recombination / single-stranded DNA helicase activity / ATP-dependent DNA damage sensor activity / regulation of double-strand break repair via homologous recombination / HDR through Single Strand Annealing (SSA) / nuclear chromosome / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / Transcriptional Regulation by E2F6 / Impaired BRCA2 binding to RAD51 / replication fork processing / Presynaptic phase of homologous DNA pairing and strand exchange / response to X-ray / ATP-dependent activity, acting on DNA / interstrand cross-link repair / condensed chromosome / DNA polymerase binding / condensed nuclear chromosome / male germ cell nucleus / cellular response to ionizing radiation / meiotic cell cycle / protein-DNA complex / cellular response to gamma radiation / PML body / double-strand break repair via homologous recombination / Meiotic recombination / Hydrolases; Acting on acid anhydrides; Acting on acid anhydrides to facilitate cellular and subcellular movement / HDR through Homologous Recombination (HRR) / response to toxic substance / single-stranded DNA binding / site of double-strand break / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / response to xenobiotic stimulus / DNA repair / chromatin binding / DNA damage response / centrosome / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / protein-containing complex / mitochondrion / nucleoplasm / ATP binding / identical protein binding / nucleus / cytoplasm / cytosol
Similarity search - Function
DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / SAM-like Helix-hairpin-helix tandem ...DNA recombination/repair protein Rad51 / DNA recombination and repair protein, RecA-like / DNA recombination and repair protein Rad51-like, C-terminal / Rad51 / DNA recombination and repair protein RecA, monomer-monomer interface / RecA family profile 2. / DNA recombination and repair protein RecA-like, ATP-binding domain / RecA family profile 1. / DNA repair Rad51/transcription factor NusA, alpha-helical / SAM-like Helix-hairpin-helix tandem / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
ADENOSINE-5'-TRIPHOSPHATE / DNA / DNA (> 10) / DNA repair protein RAD51 homolog 1
Similarity search - Component
Biological speciesHomo sapiens (human)
MethodELECTRON MICROSCOPY / helical reconstruction / cryo EM / Resolution: 3.4 Å
AuthorsAppleby, R. / Pellegrini, L.
Funding support United Kingdom, 1items
OrganizationGrant numberCountry
Wellcome Trust221892/Z/20/Z United Kingdom
CitationJournal: Mol Cell / Year: 2024
Title: RAD51 protects abasic sites to prevent replication fork breakage.
Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele ...Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele Fachinetti / Luca Pellegrini / Vincenzo Costanzo /
Abstract: Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture ...Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture of abasic DNA is prevented remains poorly understood. Here, using cryoelectron microscopy (cryo-EM), Xenopus laevis egg extracts, and human cells, we show that RAD51 nucleofilaments specifically recognize and protect abasic sites, which increase RAD51 association rate to DNA. In the absence of BRCA2 or RAD51, abasic sites accumulate as a result of DNA base methylation, oxidation, and deamination, inducing abasic ssDNA gaps that make replicating DNA fibers sensitive to APE1. RAD51 assembled on abasic DNA prevents abasic site cleavage by the MRE11-RAD50 complex, suppressing replication fork breakage triggered by an excess of abasic sites or POLθ polymerase inhibition. Our study highlights the critical role of BRCA2 and RAD51 in safeguarding against unrepaired abasic sites in DNA templates stemming from base alterations, ensuring genomic stability.
History
DepositionDec 6, 2023Deposition site: PDBE / Processing site: PDBE
Revision 1.0Sep 4, 2024Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Sep 4, 2024Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Sep 11, 2024Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 2.0May 21, 2025Group: Advisory / Atomic model ...Advisory / Atomic model / Data collection / Derived calculations / Structure summary
Category: atom_site / em_admin ...atom_site / em_admin / pdbx_entry_details / pdbx_nonpoly_scheme / pdbx_struct_conn_angle / pdbx_validate_close_contact / struct_conn
Item: _atom_site.auth_asym_id / _atom_site.auth_seq_id ..._atom_site.auth_asym_id / _atom_site.auth_seq_id / _em_admin.last_update / _pdbx_entry_details.has_protein_modification / _pdbx_nonpoly_scheme.pdb_seq_num / _pdbx_nonpoly_scheme.pdb_strand_id / _pdbx_struct_conn_angle.ptnr1_auth_asym_id / _pdbx_struct_conn_angle.ptnr1_auth_comp_id / _pdbx_struct_conn_angle.ptnr1_auth_seq_id / _pdbx_struct_conn_angle.ptnr1_label_asym_id / _pdbx_struct_conn_angle.ptnr1_label_atom_id / _pdbx_struct_conn_angle.ptnr1_label_comp_id / _pdbx_struct_conn_angle.ptnr1_label_seq_id / _pdbx_struct_conn_angle.ptnr2_auth_asym_id / _pdbx_struct_conn_angle.ptnr2_auth_seq_id / _pdbx_struct_conn_angle.ptnr3_auth_asym_id / _pdbx_struct_conn_angle.ptnr3_auth_comp_id / _pdbx_struct_conn_angle.ptnr3_auth_seq_id / _pdbx_struct_conn_angle.ptnr3_label_asym_id / _pdbx_struct_conn_angle.ptnr3_label_atom_id / _pdbx_struct_conn_angle.ptnr3_label_comp_id / _pdbx_struct_conn_angle.ptnr3_label_seq_id / _pdbx_struct_conn_angle.value / _pdbx_validate_close_contact.auth_seq_id_2 / _struct_conn.pdbx_dist_value / _struct_conn.ptnr1_auth_asym_id / _struct_conn.ptnr1_auth_comp_id / _struct_conn.ptnr1_auth_seq_id / _struct_conn.ptnr1_label_asym_id / _struct_conn.ptnr1_label_atom_id / _struct_conn.ptnr1_label_comp_id / _struct_conn.ptnr1_label_seq_id / _struct_conn.ptnr2_auth_asym_id / _struct_conn.ptnr2_auth_comp_id / _struct_conn.ptnr2_auth_seq_id / _struct_conn.ptnr2_label_asym_id / _struct_conn.ptnr2_label_atom_id / _struct_conn.ptnr2_label_comp_id
Revision 1.1May 21, 2025Data content type: EM metadata / Data content type: EM metadata / Group: Experimental summary / Data content type: EM metadata / Category: em_admin / Data content type: EM metadata / Item: _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA repair protein RAD51 homolog 1
B: DNA repair protein RAD51 homolog 1
C: DNA repair protein RAD51 homolog 1
D: DNA repair protein RAD51 homolog 1
E: DNA repair protein RAD51 homolog 1
F: DNA repair protein RAD51 homolog 1
G: DNA repair protein RAD51 homolog 1
H: DNA repair protein RAD51 homolog 1
I: DNA (5'-D(P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*G)-3')
J: DNA (5'-D(P*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*A)-3')
hetero molecules


Theoretical massNumber of molelcules
Total (without water)313,85334
Polymers309,15410
Non-polymers4,69924
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551
Buried area52050 Å2
ΔGint-381 kcal/mol
Surface area97320 Å2
MethodPISA

-
Components

#1: Protein
DNA repair protein RAD51 homolog 1 / HsRAD51 / hRAD51 / RAD51 homolog A


Mass: 37009.125 Da / Num. of mol.: 8
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51, RAD51A, RECA / Production host: Escherichia coli (E. coli) / References: UniProt: Q06609
#2: DNA chain DNA (5'-D(P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*G)-3')


Mass: 6282.902 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. ...Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. The sequence consists of 7 x TG(3DR) + TG, as helically averaged version of the DNA sequence: GGTAT(3DR)CA(3DR)TG(3DR)TA(3DR)AC(3DR)TGAGC, which contains 5 central, equally spaced abasic sites flanked by 5 nucleotides.
Source: (synth.) Homo sapiens (human)
#3: DNA chain DNA (5'-D(P*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*A)-3')


Mass: 6798.423 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: The sequence consists of 7 x CAC + CA, as helically averaged version of the DNA sequence: GCTCACGTCTACCACTGCATACC
Source: (synth.) Homo sapiens (human)
#4: Chemical
ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 16 / Source method: obtained synthetically / Formula: Ca
#5: Chemical
ChemComp-ATP / ADENOSINE-5'-TRIPHOSPHATE


Mass: 507.181 Da / Num. of mol.: 8 / Source method: obtained synthetically / Formula: C10H16N5O13P3 / Comment: ATP, energy-carrying molecule*YM
Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: FILAMENT / 3D reconstruction method: helical reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1RAD51 nucleoprotein filament on double-stranded abasic DNACOMPLEX#1-#30MULTIPLE SOURCES
2DNA repair proteinCOMPLEX#11RECOMBINANT
3DNACOMPLEX#2-#31RECOMBINANT
Molecular weightExperimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
22Homo sapiens (human)9606
33Homo sapiens (human)9606
Source (recombinant)
IDEntity assembly-IDOrganismNcbi tax-ID
22Escherichia coli (E. coli)562
33synthetic construct (others)32630
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Calibrated magnification: 130000 X / Nominal defocus max: 2600 nm / Nominal defocus min: 800 nm
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingAverage exposure time: 1.2 sec. / Electron dose: 52.968 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of real images: 10084
Details: Images were collected in movie mode at 44 frames per movie

-
Processing

EM software
IDNameVersionCategory
1RELION3.1particle selection
2EPUimage acquisition
4CTFFIND4CTF correction
7Coot0.9.8.1model fitting
12RELION3.13D reconstruction
13PHENIX1.21rc1-4985model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Helical symmertyAngular rotation/subunit: 56 ° / Axial rise/subunit: 15.8 Å / Axial symmetry: C1
Particle selectionNum. of particles selected: 1791680
3D reconstructionResolution: 3.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 8853 / Symmetry type: HELICAL
Atomic model buildingProtocol: OTHER / Space: REAL
Atomic model buildingPDB-ID: 8BR2
Accession code: 8BR2 / Source name: PDB / Type: experimental model
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00820573
ELECTRON MICROSCOPYf_angle_d0.62227974
ELECTRON MICROSCOPYf_dihedral_angle_d13.2187749
ELECTRON MICROSCOPYf_chiral_restr0.0443186
ELECTRON MICROSCOPYf_plane_restr0.0053447

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more