+Open data
-Basic information
Entry | Database: EMDB / ID: EMD-19051 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | RAD51 nucleoprotein filament on double-stranded abasic DNA | |||||||||
Map data | local anisotropy sharpened map | |||||||||
Sample |
| |||||||||
Keywords | Homologous recombination / DNA replication / abasic DNA / DNA BINDING PROTEIN | |||||||||
Function / homology | Function and homology information presynaptic intermediate filament cytoskeleton / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to camptothecin / DNA recombinase assembly / telomere maintenance via telomere lengthening / positive regulation of DNA ligation / double-strand break repair involved in meiotic recombination / nuclear ubiquitin ligase complex / DNA strand invasion ...presynaptic intermediate filament cytoskeleton / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to camptothecin / DNA recombinase assembly / telomere maintenance via telomere lengthening / positive regulation of DNA ligation / double-strand break repair involved in meiotic recombination / nuclear ubiquitin ligase complex / DNA strand invasion / mitotic recombination / cellular response to hydroxyurea / DNA strand exchange activity / lateral element / replication-born double-strand break repair via sister chromatid exchange / telomere maintenance via recombination / regulation of DNA damage checkpoint / Impaired BRCA2 binding to PALB2 / single-stranded DNA helicase activity / reciprocal meiotic recombination / Homologous DNA Pairing and Strand Exchange / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / HDR through Single Strand Annealing (SSA) / ATP-dependent DNA damage sensor activity / Impaired BRCA2 binding to RAD51 / regulation of double-strand break repair via homologous recombination / nuclear chromosome / DNA unwinding involved in DNA replication / replication fork processing / Transcriptional Regulation by E2F6 / Presynaptic phase of homologous DNA pairing and strand exchange / ATP-dependent activity, acting on DNA / interstrand cross-link repair / DNA polymerase binding / condensed chromosome / condensed nuclear chromosome / male germ cell nucleus / meiotic cell cycle / cellular response to ionizing radiation / double-strand break repair via homologous recombination / regulation of protein phosphorylation / HDR through Homologous Recombination (HRR) / PML body / Meiotic recombination / single-stranded DNA binding / site of double-strand break / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / DNA repair / centrosome / DNA damage response / chromatin binding / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / ATP hydrolysis activity / protein-containing complex / mitochondrion / nucleoplasm / ATP binding / identical protein binding / nucleus / cytosol / cytoplasm Similarity search - Function | |||||||||
Biological species | Homo sapiens (human) | |||||||||
Method | helical reconstruction / cryo EM / Resolution: 3.4 Å | |||||||||
Authors | Appleby R / Pellegrini L | |||||||||
Funding support | United Kingdom, 1 items
| |||||||||
Citation | Journal: Mol Cell / Year: 2024 Title: RAD51 protects abasic sites to prevent replication fork breakage. Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele ...Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele Fachinetti / Luca Pellegrini / Vincenzo Costanzo / Abstract: Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture ...Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture of abasic DNA is prevented remains poorly understood. Here, using cryoelectron microscopy (cryo-EM), Xenopus laevis egg extracts, and human cells, we show that RAD51 nucleofilaments specifically recognize and protect abasic sites, which increase RAD51 association rate to DNA. In the absence of BRCA2 or RAD51, abasic sites accumulate as a result of DNA base methylation, oxidation, and deamination, inducing abasic ssDNA gaps that make replicating DNA fibers sensitive to APE1. RAD51 assembled on abasic DNA prevents abasic site cleavage by the MRE11-RAD50 complex, suppressing replication fork breakage triggered by an excess of abasic sites or POLθ polymerase inhibition. Our study highlights the critical role of BRCA2 and RAD51 in safeguarding against unrepaired abasic sites in DNA templates stemming from base alterations, ensuring genomic stability. | |||||||||
History |
|
-Structure visualization
-Downloads & links
-EMDB archive
Map data | emd_19051.map.gz | 28.3 MB | EMDB map data format | |
---|---|---|---|---|
Header (meta data) | emd-19051-v30.xml emd-19051.xml | 20.4 KB 20.4 KB | Display Display | EMDB header |
Images | emd_19051.png | 85.6 KB | ||
Filedesc metadata | emd-19051.cif.gz | 6.7 KB | ||
Others | emd_19051_half_map_1.map.gz emd_19051_half_map_2.map.gz | 23.4 MB 23.4 MB | ||
Archive directory | http://ftp.pdbj.org/pub/emdb/structures/EMD-19051 ftp://ftp.pdbj.org/pub/emdb/structures/EMD-19051 | HTTPS FTP |
-Validation report
Summary document | emd_19051_validation.pdf.gz | 853.6 KB | Display | EMDB validaton report |
---|---|---|---|---|
Full document | emd_19051_full_validation.pdf.gz | 853.2 KB | Display | |
Data in XML | emd_19051_validation.xml.gz | 10.7 KB | Display | |
Data in CIF | emd_19051_validation.cif.gz | 12.6 KB | Display | |
Arichive directory | https://ftp.pdbj.org/pub/emdb/validation_reports/EMD-19051 ftp://ftp.pdbj.org/pub/emdb/validation_reports/EMD-19051 | HTTPS FTP |
-Related structure data
Related structure data | 8rcfMC 8rcdC C: citing same article (ref.) M: atomic model generated by this map |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
EMDB pages | EMDB (EBI/PDBe) / EMDataResource |
---|---|
Related items in Molecule of the Month |
-Map
File | Download / File: emd_19051.map.gz / Format: CCP4 / Size: 30.5 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Annotation | local anisotropy sharpened map | ||||||||||||||||||||||||||||||||||||
Projections & slices | Image control
Images are generated by Spider. | ||||||||||||||||||||||||||||||||||||
Voxel size | X=Y=Z: 1.304 Å | ||||||||||||||||||||||||||||||||||||
Density |
| ||||||||||||||||||||||||||||||||||||
Symmetry | Space group: 1 | ||||||||||||||||||||||||||||||||||||
Details | EMDB XML:
|
-Supplemental data
-Sample components
-Entire : RAD51 nucleoprotein filament on double-stranded abasic DNA
Entire | Name: RAD51 nucleoprotein filament on double-stranded abasic DNA |
---|---|
Components |
|
-Supramolecule #1: RAD51 nucleoprotein filament on double-stranded abasic DNA
Supramolecule | Name: RAD51 nucleoprotein filament on double-stranded abasic DNA type: complex / ID: 1 / Parent: 0 / Macromolecule list: #1-#3 |
---|
-Supramolecule #2: DNA repair protein
Supramolecule | Name: DNA repair protein / type: complex / ID: 2 / Parent: 1 / Macromolecule list: #1 |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
-Supramolecule #3: DNA
Supramolecule | Name: DNA / type: complex / ID: 3 / Parent: 1 / Macromolecule list: #2-#3 |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
-Macromolecule #1: DNA repair protein RAD51 homolog 1
Macromolecule | Name: DNA repair protein RAD51 homolog 1 / type: protein_or_peptide / ID: 1 / Number of copies: 8 / Enantiomer: LEVO |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
Molecular weight | Theoretical: 37.009125 KDa |
Recombinant expression | Organism: Escherichia coli (E. coli) |
Sequence | String: MAMQMQLEAN ADTSVEEESF GPQPISRLEQ CGINANDVKK LEEAGFHTVE AVAYAPKKEL INIKGISEAK ADKILAEAAK LVPMGFTTA TEFHQRRSEI IQITTGSKEL DKLLQGGIET GSITEMFGEF RTGKTQICHT LAVTCQLPID RGGGEGKAMY I DTEGTFRP ...String: MAMQMQLEAN ADTSVEEESF GPQPISRLEQ CGINANDVKK LEEAGFHTVE AVAYAPKKEL INIKGISEAK ADKILAEAAK LVPMGFTTA TEFHQRRSEI IQITTGSKEL DKLLQGGIET GSITEMFGEF RTGKTQICHT LAVTCQLPID RGGGEGKAMY I DTEGTFRP ERLLAVAERY GLSGSDVLDN VAYARAFNTD HQTQLLYQAS AMMVESRYAL LIVDSATALY RTDYSGRGEL SA RQMHLAR FLRMLLRLAD EFGVAVVITN QVVAQVDGAA MFAADPKKPI GGNIIAHAST TRLYLRKGRG ETRICKIYDS PCL PEAEAM FAINADGVGD AKD UniProtKB: DNA repair protein RAD51 homolog 1 |
-Macromolecule #2: DNA (5'-D(P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*T...
Macromolecule | Name: DNA (5'-D(P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*GP*(3DR)P*TP*G)-3') type: dna / ID: 2 Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. ...Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. The sequence consists of 7 x TG(3DR) + TG, as helically averaged version of the DNA sequence: GGTAT(3DR)CA(3DR)TG(3DR)TA(3DR)AC(3DR)TGAGC, which contains 5 central, equally spaced abasic sites flanked by 5 nucleotides. Number of copies: 1 / Classification: DNA |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
Molecular weight | Theoretical: 6.282902 KDa |
Sequence | String: (DT)(DG)(3DR)(DT)(DG)(3DR)(DT)(DG)(3DR)(DT) (DG)(3DR)(DT)(DG)(3DR)(DT)(DG)(3DR) (DT) (DG)(3DR)(DT)(DG) |
-Macromolecule #3: DNA (5'-D(P*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP...
Macromolecule | Name: DNA (5'-D(P*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*AP*CP*CP*A)-3') type: dna / ID: 3 Details: The sequence consists of 7 x CAC + CA, as helically averaged version of the DNA sequence: GCTCACGTCTACCACTGCATACC Number of copies: 1 / Classification: DNA |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
Molecular weight | Theoretical: 6.798423 KDa |
Sequence | String: (DC)(DA)(DC)(DC)(DA)(DC)(DC)(DA)(DC)(DC) (DA)(DC)(DC)(DA)(DC)(DC)(DA)(DC)(DC)(DA) (DC)(DC)(DA) |
-Macromolecule #4: CALCIUM ION
Macromolecule | Name: CALCIUM ION / type: ligand / ID: 4 / Number of copies: 16 / Formula: CA |
---|---|
Molecular weight | Theoretical: 40.078 Da |
-Macromolecule #5: ADENOSINE-5'-TRIPHOSPHATE
Macromolecule | Name: ADENOSINE-5'-TRIPHOSPHATE / type: ligand / ID: 5 / Number of copies: 8 / Formula: ATP |
---|---|
Molecular weight | Theoretical: 507.181 Da |
Chemical component information | ChemComp-ATP: |
-Experimental details
-Structure determination
Method | cryo EM |
---|---|
Processing | helical reconstruction |
Aggregation state | filament |
-Sample preparation
Buffer | pH: 7.5 |
---|---|
Grid | Model: UltrAuFoil R1.2/1.3 / Material: GOLD / Mesh: 300 / Pretreatment - Type: GLOW DISCHARGE / Pretreatment - Time: 60 sec. |
Vitrification | Cryogen name: ETHANE / Instrument: FEI VITROBOT MARK IV |
-Electron microscopy
Microscope | FEI TITAN KRIOS |
---|---|
Image recording | Film or detector model: GATAN K3 (6k x 4k) / Number real images: 10084 / Average exposure time: 1.2 sec. / Average electron dose: 52.968 e/Å2 Details: Images were collected in movie mode at 44 frames per movie |
Electron beam | Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN |
Electron optics | Calibrated magnification: 130000 / Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Nominal defocus max: 2.6 µm / Nominal defocus min: 0.8 µm |
Sample stage | Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER / Cooling holder cryogen: NITROGEN |
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
-Image processing
Final reconstruction | Applied symmetry - Helical parameters - Δz: 15.8 Å Applied symmetry - Helical parameters - Δ&Phi: 56.0 ° Applied symmetry - Helical parameters - Axial symmetry: C1 (asymmetric) Resolution.type: BY AUTHOR / Resolution: 3.4 Å / Resolution method: FSC 0.143 CUT-OFF / Software - Name: RELION (ver. 3.1) / Number images used: 8853 |
---|---|
Segment selection | Number selected: 1791680 / Software - Name: RELION (ver. 3.1) |
Startup model | Type of model: OTHER |
Final angle assignment | Type: NOT APPLICABLE |