+
Open data
-
Basic information
| Entry | Database: PDB / ID: 8ipy | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | human nuclear pre-60S ribosomal particle - State D' | |||||||||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||||||||
Keywords | RIBOSOME / GNL2 / nuclear / pre-60S | |||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationmitotic nuclear division / protein localization to nucleoplasm / negative regulation of transcription of nucleolar large rRNA by RNA polymerase I / negative regulation of RNA polymerase II regulatory region sequence-specific DNA binding / positive regulation of protein localization to chromosome, telomeric region / regulation of RIG-I signaling pathway / : / dendrite extension / inner cell mass cell differentiation / preribosome binding ...mitotic nuclear division / protein localization to nucleoplasm / negative regulation of transcription of nucleolar large rRNA by RNA polymerase I / negative regulation of RNA polymerase II regulatory region sequence-specific DNA binding / positive regulation of protein localization to chromosome, telomeric region / regulation of RIG-I signaling pathway / : / dendrite extension / inner cell mass cell differentiation / preribosome binding / hematopoietic stem cell homeostasis / lamin filament / regulation of cellular senescence / regulation of Notch signaling pathway / regulation of megakaryocyte differentiation / regulation of fatty acid biosynthetic process / miRNA-mediated post-transcriptional gene silencing / PeBoW complex / positive regulation of protein sumoylation / negative regulation of G2/M transition of mitotic cell cycle / miRNA-mediated gene silencing by inhibition of translation / translation at presynapse / maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / positive regulation of protein K63-linked deubiquitination / blastocyst formation / negative regulation of mitotic cell cycle / protein localization to nucleolus / regulation of translation involved in cellular response to UV / eukaryotic 80S initiation complex / ribosomal protein import into nucleus / negative regulation of formation of translation preinitiation complex / axial mesoderm development / regulation of G1 to G0 transition / protein-DNA complex disassembly / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator / 90S preribosome assembly / regulation of glycolytic process / alpha-beta T cell differentiation / skeletal system morphogenesis / positive regulation of DNA damage response, signal transduction by p53 class mediator / GAIT complex / negative regulation of cell-cell adhesion / regulation of reactive oxygen species metabolic process / TORC2 complex binding / maturation of 5.8S rRNA / stem cell division / regulation of aerobic respiration / G1 to G0 transition / middle ear morphogenesis / stem cell population maintenance / cytoplasmic side of rough endoplasmic reticulum membrane / rRNA metabolic process / regulation of protein phosphorylation / negative regulation of DNA replication / mitotic G2 DNA damage checkpoint signaling / positive regulation of dendritic spine development / ribosomal large subunit binding / homeostatic process / preribosome, large subunit precursor / macrophage chemotaxis / negative regulation of signal transduction by p53 class mediator / positive regulation of telomere maintenance / lung morphogenesis / rRNA transcription / positive regulation of natural killer cell proliferation / Protein hydroxylation / nuclear-transcribed mRNA catabolic process / Peptide chain elongation / Selenocysteine synthesis / Formation of a pool of free 40S subunits / ribosomal large subunit export from nucleus / Eukaryotic Translation Termination / blastocyst development / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / ubiquitin ligase inhibitor activity / Viral mRNA Translation / ribonucleoprotein complex binding / positive regulation of signal transduction by p53 class mediator / somitogenesis / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / protein localization to nucleus / negative regulation of ubiquitin-dependent protein catabolic process / GTP hydrolysis and joining of the 60S ribosomal subunit / L13a-mediated translational silencing of Ceruloplasmin expression / ribosomal subunit export from nucleus / negative regulation of protein-containing complex assembly / protein targeting / Major pathway of rRNA processing in the nucleolus and cytosol / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / protein-RNA complex assembly / maturation of LSU-rRNA / Notch signaling pathway / rough endoplasmic reticulum / translation initiation factor activity / MDM2/MDM4 family protein binding / embryo implantation / negative regulation of protein ubiquitination / negative regulation of proteasomal ubiquitin-dependent protein catabolic process / cellular response to interleukin-4 Similarity search - Function | |||||||||||||||||||||||||||||||||
| Biological species | Homo sapiens (human) | |||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.2 Å | |||||||||||||||||||||||||||||||||
Authors | Zhang, Y. / Gao, N. | |||||||||||||||||||||||||||||||||
| Funding support | China, 1items
| |||||||||||||||||||||||||||||||||
Citation | Journal: Cell Res / Year: 2023Title: Visualizing the nucleoplasmic maturation of human pre-60S ribosomal particles. Authors: Yunyang Zhang / Xiaomeng Liang / Sha Luo / Yan Chen / Yu Li / Chengying Ma / Ningning Li / Ning Gao / ![]() Abstract: Eukaryotic ribosome assembly is a highly orchestrated process that involves over two hundred protein factors. After early assembly events on nascent rRNA in the nucleolus, pre-60S particles undergo ...Eukaryotic ribosome assembly is a highly orchestrated process that involves over two hundred protein factors. After early assembly events on nascent rRNA in the nucleolus, pre-60S particles undergo continuous maturation steps in the nucleoplasm, and prepare for nuclear export. Here, we report eleven cryo-EM structures of the nuclear pre-60S particles isolated from human cells through epitope-tagged GNL2, at resolutions of 2.8-4.3 Å. These high-resolution snapshots provide fine details for several major structural remodeling events at a virtual temporal resolution. Two new human nuclear factors, L10K and C11orf98, were also identified. Comparative structural analyses reveal that many assembly factors act as successive place holders to control the timing of factor association/dissociation events. They display multi-phasic binding properties for different domains and generate complex binding inter-dependencies as a means to guide the rRNA maturation process towards its mature conformation. Overall, our data reveal that nuclear assembly of human pre-60S particles is generally hierarchical with short branch pathways, and a few factors display specific roles as rRNA chaperones by confining rRNA helices locally to facilitate their folding, such as the C-terminal domain of SDAD1. | |||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 8ipy.cif.gz | 3.6 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb8ipy.ent.gz | Display | PDB format | |
| PDBx/mmJSON format | 8ipy.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/ip/8ipy ftp://data.pdbj.org/pub/pdb/validation_reports/ip/8ipy | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 35651MC ![]() 8idtC ![]() 8idyC ![]() 8ie3C ![]() 8ineC ![]() 8infC ![]() 8inkC ![]() 8ipdC ![]() 8ipxC ![]() 8ir1C ![]() 8ir3C M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein , 14 types, 14 molecules N679ruvwzW4tcq
| #1: Protein | Mass: 80005.492 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NVU7 |
|---|---|
| #3: Protein | Mass: 26620.010 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P56537 |
| #4: Protein | Mass: 19666.258 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9UHA3 |
| #6: Protein | Mass: 15230.225 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O00488 |
| #33: Protein | Mass: 40312.742 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9H6F5 |
| #34: Protein | Mass: 62098.242 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BVP2 |
| #35: Protein | Mass: 27602.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9UKD2 |
| #36: Protein | Mass: 83796.094 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q13823 |
| #38: Protein | Mass: 15268.361 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BRT6 |
| #41: Protein | Mass: 53387.141 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NVX2 |
| #43: Protein | Mass: 74107.820 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BZE4 |
| #48: Protein | Mass: 34285.309 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BYG3 |
| #50: Protein | Mass: 55089.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O76021 |
| #57: Protein | Mass: 68114.727 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O00541 |
-RNA chain , 4 types, 4 molecules 28x3
| #2: RNA chain | Mass: 1636438.500 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Details: NCBI Reference Sequence: NR_146154.1 / Source: (natural) Homo sapiens (human) |
|---|---|
| #5: RNA chain | Mass: 50157.676 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: GenBank: KY962518 |
| #49: RNA chain | Mass: 31330.174 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: X17626.1: ...Details: X17626.1: gccgatcaatcgccccgggggtgcctccgggctcctcggggtgcgcggctgggggttccctcgcagggcccgccgggggccctccgtccccctaagcgcagacccggcggcgtccgccctcctcttgccgccgcgcccgccccttccccctccccccgcgggccctgcgtggtcacgcgtcgggtggcgggggggagaggggggcgcgcccggctgagagagacggggagggcggcgccgccgccggaagacggagagggaaagagagagccggctcgggccgagttcccgtggccgccgcctgcggtccgggttcctccctcggggggctccctcgcgccgcgcgcggctcggggttcggggttcgtcggccccggccgggtggaaggtcccgtgcccgtcgtcgtcgtcgtcgcgcgtcgtcggcggtgggggcgtgttgcgtgcggtgtggtggtgggggaggaggaaggcgggtccggaaggggaagggtgccggcggggagagagggtcgggggagcgcgtcccggtcgccgcggttccgccgcccgcccccggtggcggcccggcgtccggccgaccggccgctccccgcgcccctcctcctccccgccgcccctcctccgaggccccgcccgtcctcctcgccctccccgcgcgtacgcgcgcgcgcccgcccgcccggctcgcctcgcggcgcgtcggccggggccgggagcccgccccgccgcccgcccgtggccgcggcgccggggttcgcgtgtccccggcggcgacccgcgggacgccgcggtgtcgtccgccgtcgcgcgcccgcctccggctcgcggccgcgccgcgccgcgccggggccccgtcccgagcttccgcgtcggggcggcgcggctccgccgccgcgtcctcggacccgtccccccgacctccgcgggggagacgcgccggggcgtgcggcgcccgtcccgcccccggcccgtgcccctccctccggtcgtcccgctccggcggggcggcgcgggggcgccgtcggccgcgcgctctctctcccgtcgcctctccccctcgccgggcccgtctcccgacggagcgtcgggcgggcggtcgggccggcgcgattccgtccgtccgtccgccgagcggcccgtccccctccgaga Source: (natural) Homo sapiens (human) |
| #56: RNA chain | Mass: 38651.887 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) |
+60S ribosomal protein ... , 39 types, 39 molecules ABDEGHILMPQSUVXZabehlmnopyCRTY...
-Ribosome biogenesis protein ... , 2 types, 2 molecules Jf
| #14: Protein | Mass: 30136.703 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O95478 |
|---|---|
| #59: Protein | Mass: 54498.402 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NZM5 |
-Non-polymers , 2 types, 2 molecules 


| #60: Chemical | ChemComp-GTP / |
|---|---|
| #61: Chemical | ChemComp-MG / |
-Details
| Has ligand of interest | N |
|---|---|
| Has protein modification | N |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: cryo-EM structure of human nuclear pre-60S ribosomal particle - State D' Type: RIBOSOME / Entity ID: #1-#51, #57-#58, #52-#55, #59, #56 / Source: NATURAL |
|---|---|
| Source (natural) | Organism: Homo sapiens (human) |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: OTHER |
| Electron lens | Mode: DIFFRACTION / Nominal defocus max: 1800 nm / Nominal defocus min: 1200 nm |
| Image recording | Electron dose: 1.8 e/Å2 / Film or detector model: GATAN K2 QUANTUM (4k x 4k) |
-
Processing
| EM software | Name: PHENIX / Version: 1.19.2_4158: / Category: model refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 26584 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi




Homo sapiens (human)
China, 1items
Citation




















PDBj











































FIELD EMISSION GUN