[English] 日本語
Yorodumi
- PDB-8ipy: human nuclear pre-60S ribosomal particle - State D' -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8ipy
Titlehuman nuclear pre-60S ribosomal particle - State D'
Components
  • (60S ribosomal protein ...) x 39
  • (Ribosome biogenesis protein ...) x 2
  • 28S rRNA
  • 5.8S rRNA
  • 5S rRNA
  • Coiled-coil domain-containing protein 86
  • Eukaryotic translation initiation factor 6
  • G Protein Nucleolar 2
  • GTP-binding protein 4
  • Guanine nucleotide-binding protein-like 3
  • ITS2
  • MKI67 FHA domain-interacting nucleolar phosphoprotein
  • Notchless protein homolog 1
  • Pescadillo homolog
  • Probable ribosome biogenesis protein RLP24
  • Protein LLP homolog
  • Protein SDA1 homolog
  • Ribosomal L1 domain-containing protein 1
  • Zinc finger protein 593
  • mRNA turnover protein 4 homolog
KeywordsRIBOSOME / GNL2 / nuclear / pre-60S
Function / homology
Function and homology information


mitotic nuclear division / protein localization to nucleoplasm / negative regulation of transcription of nucleolar large rRNA by RNA polymerase I / negative regulation of RNA polymerase II regulatory region sequence-specific DNA binding / positive regulation of protein localization to chromosome, telomeric region / regulation of RIG-I signaling pathway / : / dendrite extension / inner cell mass cell differentiation / preribosome binding ...mitotic nuclear division / protein localization to nucleoplasm / negative regulation of transcription of nucleolar large rRNA by RNA polymerase I / negative regulation of RNA polymerase II regulatory region sequence-specific DNA binding / positive regulation of protein localization to chromosome, telomeric region / regulation of RIG-I signaling pathway / : / dendrite extension / inner cell mass cell differentiation / preribosome binding / hematopoietic stem cell homeostasis / lamin filament / regulation of cellular senescence / regulation of Notch signaling pathway / regulation of megakaryocyte differentiation / regulation of fatty acid biosynthetic process / miRNA-mediated post-transcriptional gene silencing / PeBoW complex / positive regulation of protein sumoylation / negative regulation of G2/M transition of mitotic cell cycle / miRNA-mediated gene silencing by inhibition of translation / maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / translation at presynapse / positive regulation of protein K63-linked deubiquitination / blastocyst formation / negative regulation of mitotic cell cycle / protein localization to nucleolus / regulation of translation involved in cellular response to UV / eukaryotic 80S initiation complex / ribosomal protein import into nucleus / regulation of G1 to G0 transition / negative regulation of formation of translation preinitiation complex / axial mesoderm development / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator / protein-DNA complex disassembly / skeletal system morphogenesis / regulation of glycolytic process / 90S preribosome assembly / alpha-beta T cell differentiation / positive regulation of DNA damage response, signal transduction by p53 class mediator / regulation of reactive oxygen species metabolic process / GAIT complex / negative regulation of cell-cell adhesion / maturation of 5.8S rRNA / TORC2 complex binding / stem cell division / regulation of aerobic respiration / G1 to G0 transition / middle ear morphogenesis / stem cell population maintenance / cytoplasmic side of rough endoplasmic reticulum membrane / rRNA metabolic process / negative regulation of DNA replication / regulation of protein phosphorylation / mitotic G2 DNA damage checkpoint signaling / positive regulation of dendritic spine development / ribosomal large subunit binding / homeostatic process / preribosome, large subunit precursor / negative regulation of signal transduction by p53 class mediator / macrophage chemotaxis / lung morphogenesis / positive regulation of telomere maintenance / rRNA transcription / positive regulation of natural killer cell proliferation / Protein hydroxylation / Peptide chain elongation / ribosomal large subunit export from nucleus / Selenocysteine synthesis / nuclear-transcribed mRNA catabolic process / Formation of a pool of free 40S subunits / blastocyst development / Eukaryotic Translation Termination / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / ubiquitin ligase inhibitor activity / somitogenesis / ribonucleoprotein complex binding / Viral mRNA Translation / protein localization to nucleus / negative regulation of ubiquitin-dependent protein catabolic process / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / positive regulation of signal transduction by p53 class mediator / ribosomal subunit export from nucleus / GTP hydrolysis and joining of the 60S ribosomal subunit / L13a-mediated translational silencing of Ceruloplasmin expression / negative regulation of protein-containing complex assembly / Major pathway of rRNA processing in the nucleolus and cytosol / protein targeting / maturation of LSU-rRNA / Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) / protein-RNA complex assembly / Notch signaling pathway / rough endoplasmic reticulum / translation initiation factor activity / embryo implantation / negative regulation of protein ubiquitination / MDM2/MDM4 family protein binding / negative regulation of proteasomal ubiquitin-dependent protein catabolic process / cellular response to interleukin-4
Similarity search - Function
Coiled-coil domain-containing protein 86 / SDA1 domain / Uncharacterised domain NUC130/133, N-terminal / Sda1 / : / SDA1, conserved domain / SDA1, HEAT repeat / SDA1, C-terminal / MKI67 FHA domain-interacting nucleolar phosphoprotein, FHA Ki67 binding / FHA Ki67 binding domain of hNIFK ...Coiled-coil domain-containing protein 86 / SDA1 domain / Uncharacterised domain NUC130/133, N-terminal / Sda1 / : / SDA1, conserved domain / SDA1, HEAT repeat / SDA1, C-terminal / MKI67 FHA domain-interacting nucleolar phosphoprotein, FHA Ki67 binding / FHA Ki67 binding domain of hNIFK / Ribosome biogenesis protein Nop53/GLTSCR2 / Nop53 (60S ribosomal biogenesis) / Learning associated protein 18-like / LLP homolog / : / Nucleolar GTP-binding protein 2, N-terminal domain / Nucleolar GTP-binding protein 2 / NGP1NT (NUC091) domain / NLE / NLE (NUC135) domain / Guanine nucleotide-binding protein-like 3, N-terminal domain / GNL3L/Grn1 putative GTPase / Zinc-finger double-stranded RNA-binding / Zinc finger, double-stranded RNA binding / : / Pescadillo / Pescadillo N-terminus / Ribosomal biogenesis NSA2 family / GTP-binding protein, orthogonal bundle domain superfamily / Ribosome assembly factor Mrt4 / : / : / BRCT domain / NOG, C-terminal / Nucleolar GTP-binding protein 1 / NOGCT (NUC087) domain / Nucleolar GTP-binding protein 1, Rossman-fold domain / NOG1, N-terminal helical domain / Nucleolar GTP-binding protein 1 (NOG1) / NOG1 N-terminal helical domain / Circularly permuted (CP)-type guanine nucleotide-binding (G) domain / Circularly permuted (CP)-type guanine nucleotide-binding (G) domain profile. / Matrin/U1-C-like, C2H2-type zinc finger / U1-like zinc finger / OBG-type guanine nucleotide-binding (G) domain / OBG-type guanine nucleotide-binding (G) domain profile. / Translation initiation factor IF6 / eIF-6 family / translation initiation factor 6 / 50S ribosome-binding GTPase / GTP binding domain / Ribosomal protein L6, N-terminal / Ribosomal protein L6, N-terminal domain / 50S ribosomal protein L10, insertion domain superfamily / 60S ribosomal protein L10P, insertion domain / Insertion domain in 60S ribosomal protein L10P / Ribosomal protein L30e / Ribosomal L15/L27a, N-terminal / Ribosomal protein L28e / : / breast cancer carboxy-terminal domain / Ribosomal protein L23 / Ribosomal protein L2, archaeal-type / Ribosomal L28e/Mak16 / Ribosomal L28e protein family / metallochaperone-like domain / TRASH domain / Ribosomal protein L1, 3-layer alpha/beta-sandwich / BRCT domain profile. / Ribosomal protein L13e, conserved site / Ribosomal protein L13e signature. / BRCT domain / Ribosomal protein L29e / Ribosomal L29e protein family / Ribosomal protein L1-like / Ribosomal protein L1/ribosomal biogenesis protein / Ribosomal protein L1p/L10e family / BRCT domain superfamily / Ribosomal protein L22e / Ribosomal protein L22e superfamily / Ribosomal L22e protein family / Ribosomal protein L27e, conserved site / Ribosomal protein L27e signature. / Ribosomal protein L13e / Ribosomal protein L13e / Ribosomal protein L38e / Ribosomal protein L38e superfamily / Ribosomal L38e protein family / : / Ribosomal protein L19, eukaryotic / Ribosomal protein L6e signature. / 60S ribosomal protein L18a/ L20, eukaryotes / Ribosomal protein L19/L19e conserved site / Ribosomal protein L19e signature. / Ribosomal protein L24e, conserved site / Ribosomal protein L24e signature. / Zinc finger C2H2 type domain profile. / Ribosomal protein L18/L18-A/B/e, conserved site / Ribosomal protein L18e signature. / Ribosomal protein L34e, conserved site
Similarity search - Domain/homology
GUANOSINE-5'-TRIPHOSPHATE / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Zinc finger protein 593 / Pescadillo homolog / Ribosomal L1 domain-containing protein 1 / Ribosome biogenesis protein NSA2 homolog ...GUANOSINE-5'-TRIPHOSPHATE / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Zinc finger protein 593 / Pescadillo homolog / Ribosomal L1 domain-containing protein 1 / Ribosome biogenesis protein NSA2 homolog / Large ribosomal subunit protein eL33 / Large ribosomal subunit protein uL30 / Large ribosomal subunit protein uL22 / Large ribosomal subunit protein eL13 / Large ribosomal subunit protein uL11 / Large ribosomal subunit protein uL6 / Large ribosomal subunit protein eL22 / Large ribosomal subunit protein uL4 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein uL13 / Large ribosomal subunit protein uL29 / Large ribosomal subunit protein uL15 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein eL21 / Large ribosomal subunit protein eL28 / Large ribosomal subunit protein eL29 / Large ribosomal subunit protein eL34 / Large ribosomal subunit protein eL14 / Eukaryotic translation initiation factor 6 / Large ribosomal subunit protein uL24 / Large ribosomal subunit protein eL15 / Large ribosomal subunit protein eL27 / Large ribosomal subunit protein eL43 / Large ribosomal subunit protein eL37 / Large ribosomal subunit protein eL8 / Large ribosomal subunit protein uL23 / Large ribosomal subunit protein uL14 / Large ribosomal subunit protein eL30 / Large ribosomal subunit protein eL39 / Large ribosomal subunit protein eL31 / Large ribosomal subunit protein eL32 / Large ribosomal subunit protein uL5 / Large ribosomal subunit protein uL2 / Large ribosomal subunit protein eL38 / Large ribosomal subunit protein eL19 / Large ribosomal subunit protein eL20 / Large ribosomal subunit protein eL6 / Large ribosomal subunit protein eL18 / Nucleolar GTP-binding protein 2 / Ribosomal protein uL30-like / Protein LLP homolog / Guanine nucleotide-binding protein-like 3 / MKI67 FHA domain-interacting nucleolar phosphoprotein / GTP-binding protein 4 / Coiled-coil domain-containing protein 86 / Protein SDA1 homolog / Notchless protein homolog 1 / Ribosome biogenesis protein NOP53 / Probable ribosome biogenesis protein RLP24 / mRNA turnover protein 4 homolog / Large ribosomal subunit protein eL36
Similarity search - Component
Biological speciesHomo sapiens (human)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.2 Å
AuthorsZhang, Y. / Gao, N.
Funding support China, 1items
OrganizationGrant numberCountry
National Science Foundation (NSF, China)32230051;31922036 China
CitationJournal: Cell Res / Year: 2023
Title: Visualizing the nucleoplasmic maturation of human pre-60S ribosomal particles.
Authors: Yunyang Zhang / Xiaomeng Liang / Sha Luo / Yan Chen / Yu Li / Chengying Ma / Ningning Li / Ning Gao /
Abstract: Eukaryotic ribosome assembly is a highly orchestrated process that involves over two hundred protein factors. After early assembly events on nascent rRNA in the nucleolus, pre-60S particles undergo ...Eukaryotic ribosome assembly is a highly orchestrated process that involves over two hundred protein factors. After early assembly events on nascent rRNA in the nucleolus, pre-60S particles undergo continuous maturation steps in the nucleoplasm, and prepare for nuclear export. Here, we report eleven cryo-EM structures of the nuclear pre-60S particles isolated from human cells through epitope-tagged GNL2, at resolutions of 2.8-4.3 Å. These high-resolution snapshots provide fine details for several major structural remodeling events at a virtual temporal resolution. Two new human nuclear factors, L10K and C11orf98, were also identified. Comparative structural analyses reveal that many assembly factors act as successive place holders to control the timing of factor association/dissociation events. They display multi-phasic binding properties for different domains and generate complex binding inter-dependencies as a means to guide the rRNA maturation process towards its mature conformation. Overall, our data reveal that nuclear assembly of human pre-60S particles is generally hierarchical with short branch pathways, and a few factors display specific roles as rRNA chaperones by confining rRNA helices locally to facilitate their folding, such as the C-terminal domain of SDAD1.
History
DepositionMar 15, 2023Deposition site: PDBJ / Processing site: PDBJ
Revision 1.0Aug 9, 2023Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Aug 9, 2023Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Nov 15, 2023Group: Data collection / Database references
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / citation / citation_author
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation_author.identifier_ORCID
Revision 1.2Sep 17, 2025Group: Advisory / Data collection ...Advisory / Data collection / Derived calculations / Structure summary
Category: em_admin / pdbx_entry_details ...em_admin / pdbx_entry_details / pdbx_validate_close_contact / struct_conn
Item: _em_admin.last_update / _pdbx_entry_details.has_protein_modification
Revision 1.1Sep 17, 2025Data content type: EM metadata / Data content type: EM metadata / Group: Experimental summary / Data content type: EM metadata / Category: em_admin / Data content type: EM metadata / Item: _em_admin.last_update
Revision 1.3Jul 1, 2026Group: Data collection / Database references
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / em_admin / struct_ref
Item: _chem_comp_atom.atom_id / _chem_comp_bond.atom_id_1 ..._chem_comp_atom.atom_id / _chem_comp_bond.atom_id_1 / _chem_comp_bond.atom_id_2 / _em_admin.last_update / _struct_ref.pdbx_seq_one_letter_code
Revision 1.2Jul 1, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / Category: em_admin / struct_ref / Data content type: EM metadata / EM metadata
Item: _em_admin.last_update / _struct_ref.pdbx_seq_one_letter_code

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
N: Protein SDA1 homolog
2: 28S rRNA
6: Eukaryotic translation initiation factor 6
7: Probable ribosome biogenesis protein RLP24
8: 5.8S rRNA
9: Zinc finger protein 593
A: 60S ribosomal protein L29
B: 60S ribosomal protein L3
D: 60S ribosomal protein L4
E: 60S ribosomal protein L30
G: 60S ribosomal protein L7a
H: 60S ribosomal protein L35
I: 60S ribosomal protein L9
J: Ribosome biogenesis protein NSA2 homolog
L: 60S ribosomal protein L27a
M: 60S ribosomal protein L37
P: 60S ribosomal protein L39
Q: 60S ribosomal protein L13
S: 60S ribosomal protein L14
U: 60S ribosomal protein L15
V: 60S ribosomal protein L13a
X: 60S ribosomal protein L37a
Z: 60S ribosomal protein L18
a: 60S ribosomal protein L19
b: 60S ribosomal protein L18a
e: 60S ribosomal protein L23
h: 60S ribosomal protein L26
l: 60S ribosomal protein L28
m: 60S ribosomal protein L8
n: 60S ribosomal protein L35a
o: 60S ribosomal protein L6
p: 60S ribosomal protein L7
r: Coiled-coil domain-containing protein 86
u: Guanine nucleotide-binding protein-like 3
v: mRNA turnover protein 4 homolog
w: G Protein Nucleolar 2
y: 60S ribosomal protein L12
z: Protein LLP homolog
C: 60S ribosomal protein L11
R: 60S ribosomal protein L5
W: Notchless protein homolog 1
T: 60S ribosomal protein L21
4: GTP-binding protein 4
Y: 60S ribosomal protein L17
k: 60S ribosomal protein L32
j: 60S ribosomal protein L31
d: 60S ribosomal protein L22
t: MKI67 FHA domain-interacting nucleolar phosphoprotein
x: ITS2
c: Ribosomal L1 domain-containing protein 1
1: 60S ribosomal protein L7-like 1
K: 60S ribosomal protein L36
F: 60S ribosomal protein L34
i: 60S ribosomal protein L27
O: 60S ribosomal protein L38
3: 5S rRNA
q: Pescadillo homolog
g: 60S ribosomal protein L23a
f: Ribosome biogenesis protein NOP53
hetero molecules


Theoretical massNumber of molelcules
Total (without water)3,300,36661
Polymers3,299,81959
Non-polymers5472
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Protein , 14 types, 14 molecules N679ruvwzW4tcq

#1: Protein Protein SDA1 homolog / Nucleolar protein 130 / SDA1 domain-containing protein 1 / hSDA


Mass: 80005.492 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NVU7
#3: Protein Eukaryotic translation initiation factor 6 / eIF-6 / B(2)GCN homolog / B4 integrin interactor / CAB / p27(BBP)


Mass: 26620.010 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P56537
#4: Protein Probable ribosome biogenesis protein RLP24 / Ribosomal L24 domain-containing protein 1 / Ribosomal protein L24-like


Mass: 19666.258 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9UHA3
#6: Protein Zinc finger protein 593 / Zinc finger protein T86


Mass: 15230.225 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O00488
#33: Protein Coiled-coil domain-containing protein 86 / Cytokine-induced protein with coiled-coil domain


Mass: 40312.742 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9H6F5
#34: Protein Guanine nucleotide-binding protein-like 3 / E2-induced gene 3 protein / Novel nucleolar protein 47 / NNP47 / Nucleolar GTP-binding protein 3 / ...E2-induced gene 3 protein / Novel nucleolar protein 47 / NNP47 / Nucleolar GTP-binding protein 3 / Nucleostemin


Mass: 62098.242 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BVP2
#35: Protein mRNA turnover protein 4 homolog / Ribosome assembly factor MRTO4


Mass: 27602.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9UKD2
#36: Protein G Protein Nucleolar 2 / Autoantigen NGP-1


Mass: 83796.094 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q13823
#38: Protein Protein LLP homolog / Protein LAPS18-like


Mass: 15268.361 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BRT6
#41: Protein Notchless protein homolog 1


Mass: 53387.141 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NVX2
#43: Protein GTP-binding protein 4 / Chronic renal failure gene protein / GTP-binding protein NGB


Mass: 74107.820 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BZE4
#48: Protein MKI67 FHA domain-interacting nucleolar phosphoprotein / Nucleolar phosphoprotein Nopp34 / Nucleolar protein interacting with the FHA domain of pKI-67 / hNIFK


Mass: 34285.309 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9BYG3
#50: Protein Ribosomal L1 domain-containing protein 1 / CATX-11 / Cellular senescence-inhibited gene protein / Protein PBK1


Mass: 55089.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O76021
#57: Protein Pescadillo homolog


Mass: 68114.727 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O00541

-
RNA chain , 4 types, 4 molecules 28x3

#2: RNA chain 28S rRNA


Mass: 1636438.500 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Details: NCBI Reference Sequence: NR_146154.1 / Source: (natural) Homo sapiens (human)
#5: RNA chain 5.8S rRNA


Mass: 50157.676 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: GenBank: KY962518
#49: RNA chain ITS2


Mass: 31330.174 Da / Num. of mol.: 1 / Source method: isolated from a natural source
Details: X17626.1: ...Details: X17626.1: gccgatcaatcgccccgggggtgcctccgggctcctcggggtgcgcggctgggggttccctcgcagggcccgccgggggccctccgtccccctaagcgcagacccggcggcgtccgccctcctcttgccgccgcgcccgccccttccccctccccccgcgggccctgcgtggtcacgcgtcgggtggcgggggggagaggggggcgcgcccggctgagagagacggggagggcggcgccgccgccggaagacggagagggaaagagagagccggctcgggccgagttcccgtggccgccgcctgcggtccgggttcctccctcggggggctccctcgcgccgcgcgcggctcggggttcggggttcgtcggccccggccgggtggaaggtcccgtgcccgtcgtcgtcgtcgtcgcgcgtcgtcggcggtgggggcgtgttgcgtgcggtgtggtggtgggggaggaggaaggcgggtccggaaggggaagggtgccggcggggagagagggtcgggggagcgcgtcccggtcgccgcggttccgccgcccgcccccggtggcggcccggcgtccggccgaccggccgctccccgcgcccctcctcctccccgccgcccctcctccgaggccccgcccgtcctcctcgccctccccgcgcgtacgcgcgcgcgcccgcccgcccggctcgcctcgcggcgcgtcggccggggccgggagcccgccccgccgcccgcccgtggccgcggcgccggggttcgcgtgtccccggcggcgacccgcgggacgccgcggtgtcgtccgccgtcgcgcgcccgcctccggctcgcggccgcgccgcgccgcgccggggccccgtcccgagcttccgcgtcggggcggcgcggctccgccgccgcgtcctcggacccgtccccccgacctccgcgggggagacgcgccggggcgtgcggcgcccgtcccgcccccggcccgtgcccctccctccggtcgtcccgctccggcggggcggcgcgggggcgccgtcggccgcgcgctctctctcccgtcgcctctccccctcgccgggcccgtctcccgacggagcgtcgggcgggcggtcgggccggcgcgattccgtccgtccgtccgccgagcggcccgtccccctccgaga
Source: (natural) Homo sapiens (human)
#56: RNA chain 5S rRNA


Mass: 38651.887 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)

+
60S ribosomal protein ... , 39 types, 39 molecules ABDEGHILMPQSUVXZabehlmnopyCRTY...

#7: Protein 60S ribosomal protein L29 / Large ribosomal subunit protein eL29


Mass: 17804.275 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P47914
#8: Protein 60S ribosomal protein L3 / Large ribosomal subunit protein uL3


Mass: 46211.113 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P39023
#9: Protein 60S ribosomal protein L4 / Large ribosomal subunit protein uL4


Mass: 47804.621 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P36578
#10: Protein 60S ribosomal protein L30 / Large ribosomal subunit protein eL30


Mass: 12805.092 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62888
#11: Protein 60S ribosomal protein L7a / Large ribosomal subunit protein eL8


Mass: 30061.785 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62424
#12: Protein 60S ribosomal protein L35 / Large ribosomal subunit protein uL29


Mass: 14593.624 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P42766
#13: Protein 60S ribosomal protein L9 / Large ribosomal subunit protein uL6


Mass: 21899.471 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P32969
#15: Protein 60S ribosomal protein L27a / Large ribosomal subunit protein uL15


Mass: 16604.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46776
#16: Protein 60S ribosomal protein L37 / Large ribosomal subunit protein eL37


Mass: 11111.032 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61927
#17: Protein 60S ribosomal protein L39 / Large ribosomal subunit protein eL39


Mass: 6426.759 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62891
#18: Protein 60S ribosomal protein L13 / Large ribosomal subunit protein eL13


Mass: 24321.682 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P26373
#19: Protein 60S ribosomal protein L14 / Large ribosomal subunit protein eL14


Mass: 23485.016 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P50914
#20: Protein 60S ribosomal protein L15 / Large ribosomal subunit protein eL15


Mass: 24207.285 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61313
#21: Protein 60S ribosomal protein L13a / Large ribosomal subunit protein uL13


Mass: 23633.412 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P40429
#22: Protein 60S ribosomal protein L37a / Large ribosomal subunit protein eL43


Mass: 10299.350 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61513
#23: Protein 60S ribosomal protein L18 / Large ribosomal subunit protein eL18


Mass: 21687.676 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q07020
#24: Protein 60S ribosomal protein L19 / Large ribosomal subunit protein eL19


Mass: 23535.281 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P84098
#25: Protein 60S ribosomal protein L18a / Large ribosomal subunit protein eL20


Mass: 20808.514 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q02543
#26: Protein 60S ribosomal protein L23 / Large ribosomal subunit protein uL14


Mass: 14892.505 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62829
#27: Protein 60S ribosomal protein L26 / Large ribosomal subunit protein uL24


Mass: 17303.363 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61254
#28: Protein 60S ribosomal protein L28 / Large ribosomal subunit protein eL28


Mass: 15784.622 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46779
#29: Protein 60S ribosomal protein L8 / Large ribosomal subunit protein uL2


Mass: 28088.863 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62917
#30: Protein 60S ribosomal protein L35a / Large ribosomal subunit protein eL33


Mass: 12564.743 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18077
#31: Protein 60S ribosomal protein L6 / Large ribosomal subunit protein eL6


Mass: 32810.176 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q02878
#32: Protein 60S ribosomal protein L7 / Large ribosomal subunit protein uL30


Mass: 29290.973 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18124
#37: Protein 60S ribosomal protein L12 / Large ribosomal subunit protein uL11


Mass: 17847.619 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P30050
#39: Protein 60S ribosomal protein L11 / Large ribosomal subunit protein uL5


Mass: 20288.465 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62913
#40: Protein 60S ribosomal protein L5 / Large ribosomal subunit protein uL18


Mass: 34426.789 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46777
#42: Protein 60S ribosomal protein L21 / Large ribosomal subunit protein eL21


Mass: 18609.988 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46778
#44: Protein 60S ribosomal protein L17 / Large ribosomal subunit protein uL22


Mass: 21443.170 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18621
#45: Protein 60S ribosomal protein L32 / Large ribosomal subunit protein eL32


Mass: 15898.932 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62910
#46: Protein 60S ribosomal protein L31 / Large ribosomal subunit protein eL31


Mass: 14494.938 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62899
#47: Protein 60S ribosomal protein L22 / Large ribosomal subunit protein eL22


Mass: 14813.015 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P35268
#51: Protein 60S ribosomal protein L7-like 1 / Large ribosomal subunit protein uL30-like 1


Mass: 29730.354 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q6DKI1
#52: Protein 60S ribosomal protein L36 / Large ribosomal subunit protein eL36


Mass: 12290.859 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9Y3U8
#53: Protein 60S ribosomal protein L34 / Large ribosomal subunit protein eL34


Mass: 13326.074 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P49207
#54: Protein 60S ribosomal protein L27 / Large ribosomal subunit protein eL27


Mass: 15835.831 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61353
#55: Protein 60S ribosomal protein L38 / Large ribosomal subunit protein eL38


Mass: 8238.948 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63173
#58: Protein 60S ribosomal protein L23a / Large ribosomal subunit protein uL23


Mass: 17740.193 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62750

-
Ribosome biogenesis protein ... , 2 types, 2 molecules Jf

#14: Protein Ribosome biogenesis protein NSA2 homolog / Hairy cell leukemia protein 1 / TGF-beta-inducible nuclear protein 1


Mass: 30136.703 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: O95478
#59: Protein Ribosome biogenesis protein NOP53 / Glioma tumor suppressor candidate region gene 2 protein / Protein interacting with carboxyl ...Glioma tumor suppressor candidate region gene 2 protein / Protein interacting with carboxyl terminus 1 / PICT-1 / p60


Mass: 54498.402 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9NZM5

-
Non-polymers , 2 types, 2 molecules

#60: Chemical ChemComp-GTP / GUANOSINE-5'-TRIPHOSPHATE


Mass: 523.180 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C10H16N5O14P3 / Comment: GTP, energy-carrying molecule*YM
#61: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Mg

-
Details

Has ligand of interestN
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: cryo-EM structure of human nuclear pre-60S ribosomal particle - State D'
Type: RIBOSOME / Entity ID: #1-#51, #57-#58, #52-#55, #59, #56 / Source: NATURAL
Source (natural)Organism: Homo sapiens (human)
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: OTHER
Electron lensMode: DIFFRACTION / Nominal defocus max: 1800 nm / Nominal defocus min: 1200 nm
Image recordingElectron dose: 1.8 e/Å2 / Film or detector model: GATAN K2 QUANTUM (4k x 4k)

-
Processing

EM softwareName: PHENIX / Version: 1.19.2_4158: / Category: model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 3.2 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 26584 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.011175383
ELECTRON MICROSCOPYf_angle_d1.055254901
ELECTRON MICROSCOPYf_dihedral_angle_d15.64956777
ELECTRON MICROSCOPYf_chiral_restr0.0531251
ELECTRON MICROSCOPYf_plane_restr0.00818135

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more