[English] 日本語
Yorodumi
- PDB-7utn: IscB and wRNA bound to Target DNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7utn
TitleIscB and wRNA bound to Target DNA
Components
  • DNA non-target strand
  • DNA target strand
  • IscB
  • RNA (222-MER)
KeywordsRNA BINDING PROTEIN/RNA/DNA / CRISPR / IscB / HEARO RNA / omega RNA / RNA BINDING PROTEIN-RNA-DNA complex
Function / homologyDNA / DNA (> 10) / RNA / RNA (> 10) / RNA (> 100)
Function and homology information
Biological speciessynthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.74 Å
AuthorsSchuler, G.A. / Hu, C. / Ke, A.
Funding support United States, 1items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)GM118174 United States
CitationJournal: Science / Year: 2022
Title: Structural basis for RNA-guided DNA cleavage by IscB-ωRNA and mechanistic comparison with Cas9.
Authors: Gabriel Schuler / Chunyi Hu / Ailong Ke /
Abstract: Class 2 CRISPR effectors Cas9 and Cas12 may have evolved from nucleases in IS200/IS605 transposons. IscB is about two-fifths the size of Cas9 but shares a similar domain organization. The associated ...Class 2 CRISPR effectors Cas9 and Cas12 may have evolved from nucleases in IS200/IS605 transposons. IscB is about two-fifths the size of Cas9 but shares a similar domain organization. The associated ωRNA plays the combined role of CRISPR RNA (crRNA) and trans-activating CRISPR RNA tracrRNA) to guide double-stranded DNA (dsDNA) cleavage. Here we report a 2.78-angstrom cryo-electron microscopy structure of IscB-ωRNA bound to a dsDNA target, revealing the architectural and mechanistic similarities between IscB and Cas9 ribonucleoproteins. Target-adjacent motif recognition, R-loop formation, and DNA cleavage mechanisms are explained at high resolution. ωRNA plays the equivalent function of REC domains in Cas9 and contacts the RNA-DNA heteroduplex. The IscB-specific PLMP domain is dispensable for RNA-guided DNA cleavage. The transition from ancestral IscB to Cas9 involved dwarfing the ωRNA and introducing protein domain replacements.
History
DepositionApr 27, 2022Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jun 15, 2022Provider: repository / Type: Initial release
Revision 1.1Jul 6, 2022Group: Database references / Category: citation / citation_author
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation_author.identifier_ORCID
Revision 1.2Feb 14, 2024Group: Data collection / Category: chem_comp_atom / chem_comp_bond

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
D: IscB
C: RNA (222-MER)
A: DNA target strand
B: DNA non-target strand


Theoretical massNumber of molelcules
Total (without water)165,4304
Polymers165,4304
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: native gel electrophoresis
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein IscB


Mass: 56688.477 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: OGEU01000025.1 / Source: (gene. exp.) synthetic construct (others) / Gene: IscB / Plasmid: pCDFDuet1
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
Strain (production host): T7 Express (NEB)
#2: RNA chain RNA (222-MER)


Mass: 71877.797 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) synthetic construct (others) / Plasmid: pUC57-Kan
Production host: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
Strain (production host): T7 Express (NEB)
#3: DNA chain DNA target strand


Mass: 18305.646 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: phosphorothioate (PS) bonds * GCCACGGGCTGACCTCGACTTCTAGT*C*T*C*G*T*T*CACTCTTTTGCCGTACCCTCGTGGGGCG
Source: (synth.) synthetic construct (others)
#4: DNA chain DNA non-target strand


Mass: 18557.873 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: phosphorothioate (PS) bond * CGCCCCACGAGGGTACGGCAAAAGA*G*T*T*T*T*T*TTTACTAGAAGTCGAGGTCAGCCCGTGGC
Source: (synth.) synthetic construct (others)

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Cryo-EM structure of IscB in complex with RNA and target DNA
Type: COMPLEX / Entity ID: all / Source: MULTIPLE SOURCES
Molecular weightValue: 190 kDa/nm / Experimental value: NO
Source (natural)Organism: synthetic construct (others)
Source (recombinant)Organism: Escherichia coli 'BL21-Gold(DE3)pLysS AG' (bacteria)
Strain: T7 Express (NEB)
Buffer solutionpH: 7.25
Buffer component
IDConc.NameFormulaBuffer-ID
150 mMsodium chlorideNaCl1
250 mMHEPESC8H18N2O4S1
35 mMMagnesium chlorideC9H15O6P1
42 mM2-MercaptoethanolHOCH2CH2SH1
SpecimenConc.: 0.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid mesh size: 200 divisions/in. / Grid type: Quantifoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K / Details: blot for 6.5 seconds before plunging

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 1000 nm
Image recordingElectron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.18.2_3874: / Classification: refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 2.74 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 159201 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.0078635
ELECTRON MICROSCOPYf_angle_d0.66112736
ELECTRON MICROSCOPYf_dihedral_angle_d19.3133079
ELECTRON MICROSCOPYf_chiral_restr0.0411567
ELECTRON MICROSCOPYf_plane_restr0.004787

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more