+
Open data
-
Basic information
Entry | Database: PDB / ID: 7utn | ||||||
---|---|---|---|---|---|---|---|
Title | IscB and wRNA bound to Target DNA | ||||||
![]() |
| ||||||
![]() | RNA BINDING PROTEIN/RNA/DNA / CRISPR / IscB / HEARO RNA / omega RNA / RNA BINDING PROTEIN-RNA-DNA complex | ||||||
Function / homology | DNA / DNA (> 10) / RNA / RNA (> 10) / RNA (> 100)![]() | ||||||
Biological species | synthetic construct (others) | ||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.74 Å | ||||||
![]() | Schuler, G.A. / Hu, C. / Ke, A. | ||||||
Funding support | ![]()
| ||||||
![]() | ![]() Title: Structural basis for RNA-guided DNA cleavage by IscB-ωRNA and mechanistic comparison with Cas9. Authors: Gabriel Schuler / Chunyi Hu / Ailong Ke / ![]() Abstract: Class 2 CRISPR effectors Cas9 and Cas12 may have evolved from nucleases in IS200/IS605 transposons. IscB is about two-fifths the size of Cas9 but shares a similar domain organization. The associated ...Class 2 CRISPR effectors Cas9 and Cas12 may have evolved from nucleases in IS200/IS605 transposons. IscB is about two-fifths the size of Cas9 but shares a similar domain organization. The associated ωRNA plays the combined role of CRISPR RNA (crRNA) and trans-activating CRISPR RNA tracrRNA) to guide double-stranded DNA (dsDNA) cleavage. Here we report a 2.78-angstrom cryo-electron microscopy structure of IscB-ωRNA bound to a dsDNA target, revealing the architectural and mechanistic similarities between IscB and Cas9 ribonucleoproteins. Target-adjacent motif recognition, R-loop formation, and DNA cleavage mechanisms are explained at high resolution. ωRNA plays the equivalent function of REC domains in Cas9 and contacts the RNA-DNA heteroduplex. The IscB-specific PLMP domain is dispensable for RNA-guided DNA cleavage. The transition from ancestral IscB to Cas9 involved dwarfing the ωRNA and introducing protein domain replacements. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 196.1 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 142.3 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Arichive directory | ![]() ![]() | HTTPS FTP |
---|
-Related structure data
Related structure data | ![]() 26782MC ![]() 8cszC ![]() 8ctlC M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
#1: Protein | Mass: 56688.477 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: OGEU01000025.1 / Source: (gene. exp.) synthetic construct (others) / Gene: IscB / Plasmid: pCDFDuet1 Production host: ![]() ![]() Strain (production host): T7 Express (NEB) |
---|---|
#2: RNA chain | Mass: 71877.797 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) synthetic construct (others) / Plasmid: pUC57-Kan Production host: ![]() ![]() Strain (production host): T7 Express (NEB) |
#3: DNA chain | Mass: 18305.646 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: phosphorothioate (PS) bonds * GCCACGGGCTGACCTCGACTTCTAGT*C*T*C*G*T*T*CACTCTTTTGCCGTACCCTCGTGGGGCG Source: (synth.) synthetic construct (others) |
#4: DNA chain | Mass: 18557.873 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: phosphorothioate (PS) bond * CGCCCCACGAGGGTACGGCAAAAGA*G*T*T*T*T*T*TTTACTAGAAGTCGAGGTCAGCCCGTGGC Source: (synth.) synthetic construct (others) |
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component | Name: Cryo-EM structure of IscB in complex with RNA and target DNA Type: COMPLEX / Entity ID: all / Source: MULTIPLE SOURCES | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Value: 190 kDa/nm / Experimental value: NO | |||||||||||||||||||||||||
Source (natural) | Organism: synthetic construct (others) | |||||||||||||||||||||||||
Source (recombinant) | Organism: ![]() ![]() Strain: T7 Express (NEB) | |||||||||||||||||||||||||
Buffer solution | pH: 7.25 | |||||||||||||||||||||||||
Buffer component |
| |||||||||||||||||||||||||
Specimen | Conc.: 0.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | |||||||||||||||||||||||||
Specimen support | Grid material: COPPER / Grid mesh size: 200 divisions/in. / Grid type: Quantifoil R1.2/1.3 | |||||||||||||||||||||||||
Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K / Details: blot for 6.5 seconds before plunging |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: TFS KRIOS |
Electron gun | Electron source: ![]() |
Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 1000 nm |
Image recording | Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
Software | Name: PHENIX / Version: 1.18.2_3874: / Classification: refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
3D reconstruction | Resolution: 2.74 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 159201 / Symmetry type: POINT | ||||||||||||||||||||||||
Refine LS restraints |
|