[English] 日本語
Yorodumi
- PDB-2m93: Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duple... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 2m93
TitleStructure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid
Components32-MER DNA
KeywordsDNA / quadruplex-duplex hybrid / duplex / quadruplex
Function / homologyDNA / DNA (> 10)
Function and homology information
MethodSOLUTION NMR / DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics
Model detailslowest energy, model1
AuthorsLim, K.W. / Phan, A.T.
CitationJournal: Angew.Chem.Int.Ed.Engl. / Year: 2013
Title: Structural basis of DNA quadruplex-duplex junction formation.
Authors: Lim, K.W. / Phan, A.T.
History
DepositionMay 30, 2013Deposition site: BMRB / Processing site: PDBJ
Revision 1.0Jul 10, 2013Provider: repository / Type: Initial release
Revision 1.1Aug 24, 2022Group: Data collection / Database references
Category: citation / database_2 ...citation / database_2 / pdbx_nmr_software / pdbx_nmr_spectrometer
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation.title / _database_2.pdbx_DOI / _database_2.pdbx_database_accession / _pdbx_nmr_software.name / _pdbx_nmr_spectrometer.model
Revision 1.2Jun 14, 2023Group: Other / Category: pdbx_database_status / Item: _pdbx_database_status.status_code_nmr_data
Revision 1.3May 15, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2 / Item: _database_2.pdbx_DOI

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: 32-MER DNA


Theoretical massNumber of molelcules
Total (without water)10,0661
Polymers10,0661
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)10 / 100structures with the lowest energy
RepresentativeModel #1lowest energy

-
Components

#1: DNA chain 32-MER DNA


Mass: 10066.420 Da / Num. of mol.: 1 / Source method: obtained synthetically

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDType
1122D 1H-1H NOESY
1212D 1H-1H JR NOESY
1322D 1H-1H COSY
1422D 1H-1H TOCSY
1522D 1H-13C HSQC
1612D 1H-13C JR HMBC
1722D 1H-31P HSQC
182H-D EXCHANGE
19315N-FILTERED
1104D-LABELED

-
Sample preparation

Details
Solution-IDContentsSolvent system
10.5-2.0 mM DNA-1, 90% H2O/10% D2O90% H2O/10% D2O
20.5-2.0 mM DNA-2, 100% D2O100% D2O
30.5-2.0 mM [U-2% 15N] DNA-3, 90% H2O/10% D2O90% H2O/10% D2O
40.2-1.0 mM [U-100% 2H] DNA-4, 100% D2O100% D2O
Sample
UnitsComponentIsotopic labelingConc. range (mg/ml)Solution-ID
mMDNA-10.5-2.01
mMDNA-20.5-2.02
mMDNA-3[U-2% 15N]0.5-2.03
mMDNA-4[U-100% 2H]0.2-1.04
Sample conditionsIonic strength: 40 mM K+ / pH: 7 / Pressure: ambient / Temperature: 298 K

-
NMR measurement

NMR spectrometer
TypeManufacturerModelField strength (MHz)Spectrometer-ID
Bruker AvanceBrukerAVANCE4001
Bruker AvanceBrukerAVANCE6002
Bruker AvanceBrukerAVANCE7003

-
Processing

NMR software
NameVersionDeveloperClassification
TopSpin2.1Bruker Biospinprocessing
Felix2007Felix NMR, Inc.peak picking
X-PLOR NIH2.29Schwieters, Kuszewski, Tjandra and Cloreprocessing
X-PLOR NIH2.29Schwieters, Kuszewski, Tjandra and Clorerefinement
RefinementMethod: DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics
Software ordinal: 1
NMR representativeSelection criteria: lowest energy
NMR ensembleConformer selection criteria: structures with the lowest energy
Conformers calculated total number: 100 / Conformers submitted total number: 10 / Representative conformer: 1

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more