[English] 日本語
Yorodumi
- PDB-1zbb: Structure of the 4_601_167 Tetranucleosome -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1zbb
TitleStructure of the 4_601_167 Tetranucleosome
Components
  • DNA STRAND 1 (ARBITRARY MODEL SEQUENCE)
  • DNA STRAND 2 (ARBITRARY MODEL SEQUENCE)
  • HISTONE H3
  • Histone H2A.1
  • Histone H2B.1
  • Histone H4
KeywordsSTRUCTURAL PROTEIN/DNA / TETRANUCLEOSOME / NUCLEOSOME / CHROMATIN / CHROMATIN FIBER / HISTONE / PROTEIN-DNA INTERACTION / NUCLEOPROTEIN / SUPERCOILED DNA / NUCLEOSOME CORE / PROTEIN-DNA COMPLEX / STRUCTURAL PROTEIN-DNA COMPLEX
Function / homology
Function and homology information


DNA-templated transcription, initiation / nucleosome / protein heterodimerization activity / DNA binding / nucleoplasm / nucleus
Similarity search - Function
Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A signature. / Histone H2A conserved site / C-terminus of histone H2A / Histone H2A, C-terminal domain / Histone 2A / Histone H2A / Histone H4 signature. ...Histone H2B signature. / Histone H2B / Histone H2B / Histone H2A signature. / Histone H2A conserved site / C-terminus of histone H2A / Histone H2A, C-terminal domain / Histone 2A / Histone H2A / Histone H4 signature. / Histone H4, conserved site / Histone H4 / Histone H4 / CENP-T/Histone H4, histone fold / Centromere kinetochore component CENP-T histone fold / TATA box binding protein associated factor / TATA box binding protein associated factor (TAF) / Histone H3 signature 1. / Histone H3 signature 2. / Histone H3 / Histone H3/CENP-A / Histone H2A/H2B/H3 / Core histone H2A/H2B/H3/H4 / Histone-fold
Similarity search - Domain/homology
DNA (> 100) / DNA (> 10) / DNA / Histone H2B 1.1 / Histone H2A type 1 / Histone H4 / Histone H3.2
Similarity search - Component
Biological speciesXenopus laevis (African clawed frog)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 9 Å
AuthorsSchalch, T. / Duda, S. / Sargent, D.F. / Richmond, T.J.
CitationJournal: Nature / Year: 2005
Title: X-ray structure of a tetranucleosome and its implications for the chromatin fibre.
Authors: Schalch, T. / Duda, S. / Sargent, D.F. / Richmond, T.J.
History
DepositionApr 8, 2005Deposition site: RCSB / Processing site: PDBJ
Revision 1.0Jul 12, 2005Provider: repository / Type: Initial release
Revision 1.1Apr 30, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Version format compliance
Revision 1.3May 14, 2014Group: Other

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
I: DNA STRAND 1 (ARBITRARY MODEL SEQUENCE)
J: DNA STRAND 2 (ARBITRARY MODEL SEQUENCE)
A: HISTONE H3
B: Histone H4
C: Histone H2A.1
D: Histone H2B.1
E: HISTONE H3
F: Histone H4
G: Histone H2A.1
H: Histone H2B.1
a: HISTONE H3
b: Histone H4
c: Histone H2A.1
d: Histone H2B.1
e: HISTONE H3
f: Histone H4
g: Histone H2A.1
h: Histone H2B.1


Theoretical massNumber of molelcules
Total (without water)431,87218
Polymers431,87218
Non-polymers00
Water0
1
I: DNA STRAND 1 (ARBITRARY MODEL SEQUENCE)
J: DNA STRAND 2 (ARBITRARY MODEL SEQUENCE)
A: HISTONE H3
B: Histone H4
C: Histone H2A.1
D: Histone H2B.1
E: HISTONE H3
F: Histone H4
G: Histone H2A.1
H: Histone H2B.1
a: HISTONE H3
b: Histone H4
c: Histone H2A.1
d: Histone H2B.1
e: HISTONE H3
f: Histone H4
g: Histone H2A.1
h: Histone H2B.1

I: DNA STRAND 1 (ARBITRARY MODEL SEQUENCE)
J: DNA STRAND 2 (ARBITRARY MODEL SEQUENCE)
A: HISTONE H3
B: Histone H4
C: Histone H2A.1
D: Histone H2B.1
E: HISTONE H3
F: Histone H4
G: Histone H2A.1
H: Histone H2B.1
a: HISTONE H3
b: Histone H4
c: Histone H2A.1
d: Histone H2B.1
e: HISTONE H3
f: Histone H4
g: Histone H2A.1
h: Histone H2B.1


Theoretical massNumber of molelcules
Total (without water)863,74336
Polymers863,74336
Non-polymers00
Water0
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
crystal symmetry operation3_656-x+1,y,-z+11
Unit cell
γ
α
β
Length a, b, c (Å)127.675, 168.445, 237.126
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number23
Space group name H-MI222
DetailsThe second part of the biological assembly is generated by the two fold axis: -X+1,Y,-Z+1

-
Components

-
DNA chain , 2 types, 2 molecules IJ

#1: DNA chain DNA STRAND 1 (ARBITRARY MODEL SEQUENCE)


Mass: 107153.336 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Tandem repeat of sequence isolated by Lowary PT, Widom J., J Mol Biol. 1998 Feb 13;276(1):19-42 SEE REMARK 999 for more details
#2: DNA chain DNA STRAND 2 (ARBITRARY MODEL SEQUENCE)


Mass: 107144.312 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Tandem repeat of sequence isolated by Lowary PT, Widom J., J Mol Biol. 1998 Feb 13;276(1):19-42 SEE REMARK 999 for more details

-
Protein , 4 types, 16 molecules AEaeBFbfCGcgDHdh

#3: Protein
HISTONE H3 /


Mass: 15303.930 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Plasmid: pET3a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(pLysS) / References: UniProt: P84233
#4: Protein
Histone H4 /


Mass: 11263.231 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Plasmid: pET3a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(pLysS) / References: UniProt: P62799
#5: Protein
Histone H2A.1 / HISTONE H2A


Mass: 13978.241 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Plasmid: pET3a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(pLysS) / References: UniProt: P06897
#6: Protein
Histone H2B.1 / HISTONE H2B


Mass: 13848.097 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Xenopus laevis (African clawed frog) / Plasmid: pET3a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(pLysS) / References: UniProt: P02281

-
Details

Sequence detailsTHE 4_601_167 TETRANUCLEOSOME IS MODELLED BASED ON THE NUCLEOSOME CORE PARTICLE STRUCTURE 1KX5. DUE ...THE 4_601_167 TETRANUCLEOSOME IS MODELLED BASED ON THE NUCLEOSOME CORE PARTICLE STRUCTURE 1KX5. DUE TO THE LOW RESOLUTION OF THE DATA THE ACTUAL 601 SEQUENCE COULD NOT BE MODELLED INTO THE TETRANUCLEOSOME STRUCTURE. THE DNA SEQUENCE USED FOR RECONSTITUTION OF THE TETRA- NUCLEOSOME IS: ATCGAAGACAGTACTGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGT AGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAA GGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTAAGTA CTGGCCGCCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGC ACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCC TAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTAAGTACTGGCCGCCCTGG AGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGC ACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCA CGTGTCAGATATATACATCCTGTGCATGTAAGTACTGGCCGCCCTGGAGAATCCCGGTGC CGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGT CCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATA TACATCCTGTGCATGTAAGTACTCTGTCTTCGAT

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 12

-
Sample preparation

CrystalDensity Matthews: 2.9 Å3/Da / Density % sol: 57.2 %
Crystal growTemperature: 294 K / Method: vapor diffusion, sitting drop / pH: 6.75
Details: magnesium chloride, potassium chloride, potassium cacodylate, trisCl, pH 6.75, VAPOR DIFFUSION, SITTING DROP, temperature 294K
Components of the solutions
IDNameCrystal-IDSol-ID
1magnesium chloride11
2potassium chloride11
3potassium cacodylate11
4trisCl11
5magnesium chloride12
6potassium chloride12
7potassium cacodylate12
8trisCl12

-
Data collection

Diffraction
IDMean temperature (K)Crystal-ID
11001
21
31
Diffraction source
SourceSiteBeamlineIDWavelength (Å)
SYNCHROTRONSLS X06SA10.9698
SYNCHROTRONSLS X06SA21.00003
SYNCHROTRONSLS X06SA30.85003
Detector
TypeIDDetectorDateDetails
MARRESEARCH1CCDAug 13, 2003Dynamically bendable mirror
MARRESEARCH2CCDAug 22, 2003Dynamically bendable mirror
MARRESEARCH3CCDOct 3, 2003Dynamically bendable mirror
Radiation
IDMonochromatorProtocolMonochromatic (M) / Laue (L)Scattering typeWavelength-ID
1LN2 cooled fixed-exit Si(111) monochromatorSINGLE WAVELENGTHMx-ray1
2LN2 cooled fixed-exit Si(111) monochromatorSINGLE WAVELENGTHMx-ray1
3LN2 cooled fixed-exit Si(111) monochromatorSINGLE WAVELENGTHMx-ray1
Radiation wavelength
IDWavelength (Å)Relative weight
10.96981
21.000031
30.850031
ReflectionResolution: 9→50 Å / Num. all: 1994 / Num. obs: 1994 / % possible obs: 97 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 0 / Redundancy: 5.7 % / Rsym value: 0.072 / Net I/σ(I): 17.28
Reflection shellResolution: 9→10 Å / Redundancy: 4.2 % / Mean I/σ(I) obs: 12.55 / Num. unique all: 542 / Rsym value: 0.087 / % possible all: 97.4

-
Processing

Software
NameVersionClassification
BEASTmodel building
REFMAC5.1.24refinement
BEASTphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 1KX5(NUCLEOSOME CORE PARTICLE)
Resolution: 9→50 Å / σ(F): 0
Details: THE STRUCTURE WAS REFINED BY RIGID BODY REFINEMENT OF NUCLEOSOME POSITIONS ONLY. NO CROSSVALIDATION WAS EMPLOYED DUE TO HIGH FLUCTUATIONS OF RFREE CAUSED BY THE SMALL NUMBER OF REFLECTIONS ...Details: THE STRUCTURE WAS REFINED BY RIGID BODY REFINEMENT OF NUCLEOSOME POSITIONS ONLY. NO CROSSVALIDATION WAS EMPLOYED DUE TO HIGH FLUCTUATIONS OF RFREE CAUSED BY THE SMALL NUMBER OF REFLECTIONS IN THE TEST SET. Since the structure was solved at very low resolution, remark 500 records have been suppressed at the request of depositors.
RfactorNum. reflection% reflection
Rwork0.386 --
obs0.386 1992 97 %
all-1992 -
Refinement stepCycle: LAST / Resolution: 9→50 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms12630 14221 0 0 26851
LS refinement shellResolution: 9→9.72 Å
RfactorNum. reflection% reflection
Rwork0.447 --
Rfree-0 -
obs--97.3 %

+
About Yorodumi

-
News

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

-
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

+
Jun 16, 2017. Omokage search with filter

Omokage search with filter

Result of Omokage search can be filtered by keywords and the database types

Related info.:Omokage search

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more