[English] 日本語
Yorodumi
- PDB-1qwb: NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hai... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1qwb
TitleNMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
ComponentssNRE26
KeywordsRNA / A-form helix / loop E motif / S-turn / disordered hairpin loop
Function / homologyRNA / RNA (> 10)
Function and homology information
MethodSOLUTION NMR / simulated annealing
AuthorsFinger, L.D. / Trantirek, L. / Johansson, C. / Feigon, J.
CitationJournal: Nucleic Acids Res. / Year: 2003
Title: Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin
Authors: Finger, L.D. / Trantirek, L. / Johansson, C. / Feigon, J.
History
DepositionSep 1, 2003Deposition site: RCSB / Processing site: RCSB
Revision 1.0Nov 25, 2003Provider: repository / Type: Initial release
Revision 1.1Apr 29, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Version format compliance
Revision 1.3Sep 9, 2020Group: Data collection / Derived calculations / Structure summary
Category: ndb_struct_conf_na / ndb_struct_na_base_pair ...ndb_struct_conf_na / ndb_struct_na_base_pair / ndb_struct_na_base_pair_step / pdbx_nmr_software / pdbx_struct_assembly / pdbx_struct_oper_list / struct / struct_conn
Item: _ndb_struct_na_base_pair.opening / _ndb_struct_na_base_pair_step.helical_twist ..._ndb_struct_na_base_pair.opening / _ndb_struct_na_base_pair_step.helical_twist / _pdbx_nmr_software.name / _struct.title
Revision 1.4May 1, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: sNRE26


Theoretical massNumber of molelcules
Total (without water)8,3661
Polymers8,3661
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_5551
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)17 / 17all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy
RepresentativeModel #1lowest energy

-
Components

#1: RNA chain sNRE26


Mass: 8366.066 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: RNA WAS PREPARED BY In vitro transcription with T7 RNA polymerase

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDType
1112D NOESY
2222D NOESY
2322D TOCSY
242DQF-COSY
2541H-13C HSQC or HMQC
1631H-15N HMQC
NMR detailsText: Assignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998).

-
Sample preparation

Details
Solution-IDContentsSolvent system
11-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O95% H2O/5% D2O
21-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 99.999% D2O99.999% D2O
31mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O95% H2O/5% D2O
41mM sNRE26 U 15N/13C, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 99.999% D2O99.999% D2O
Sample conditions
Conditions-IDIonic strengthpHPressure (kPa)Temperature (K)
1100mM KCl 7ambient 278 K
2100mM KCl 7ambient 298 K
Crystal grow
*PLUS
Method: other / Details: NMR

-
NMR measurement

RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M
Radiation wavelengthRelative weight: 1
NMR spectrometer
TypeManufacturerModelField strength (MHz)Spectrometer-ID
Bruker DMXBrukerDMX5001
Bruker DMXBrukerDMX6002

-
Processing

NMR software
NameVersionDeveloperClassification
XwinNMR2.6Brukercollection
AURELIA3.108Brukerdata analysis
X-PLORNIHBrungerstructure solution
X-PLORNIHBrungerrefinement
RefinementMethod: simulated annealing / Software ordinal: 1
NMR representativeSelection criteria: lowest energy
NMR ensembleConformer selection criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint ...Conformer selection criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy
Conformers calculated total number: 17 / Conformers submitted total number: 17

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlc1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more