[English] 日本語

- PDB-1qwb: NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hai... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 1qwb | ||||||
---|---|---|---|---|---|---|---|
Title | NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12 | ||||||
![]() | sNRE26 | ||||||
![]() | RNA / A-form helix / loop E motif / S-turn / disordered hairpin loop | ||||||
Function / homology | RNA / RNA (> 10)![]() | ||||||
Method | SOLUTION NMR / simulated annealing | ||||||
![]() | Finger, L.D. / Trantirek, L. / Johansson, C. / Feigon, J. | ||||||
![]() | ![]() Title: Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin Authors: Finger, L.D. / Trantirek, L. / Johansson, C. / Feigon, J. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 277.5 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 232.2 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Arichive directory | ![]() ![]() | HTTPS FTP |
---|
-Related structure data
-
Links
-
Assembly
Deposited unit | ![]()
| |||||||||
---|---|---|---|---|---|---|---|---|---|---|
1 |
| |||||||||
NMR ensembles |
|
-
Components
#1: RNA chain | Mass: 8366.066 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: RNA WAS PREPARED BY In vitro transcription with T7 RNA polymerase |
---|
-Experimental details
-Experiment
Experiment | Method: SOLUTION NMR | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NMR experiment |
| ||||||||||||||||||||||||||||
NMR details | Text: Assignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998). |
-
Sample preparation
Details |
| |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample conditions |
| |||||||||||||||
Crystal grow | *PLUS Method: other / Details: NMR |
-NMR measurement
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Radiation wavelength | Relative weight: 1 | |||||||||||||||
NMR spectrometer |
|
-
Processing
NMR software |
| ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method: simulated annealing / Software ordinal: 1 | ||||||||||||||||||||
NMR representative | Selection criteria: lowest energy | ||||||||||||||||||||
NMR ensemble | Conformer selection criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint ...Conformer selection criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy Conformers calculated total number: 17 / Conformers submitted total number: 17 |