[English] 日本語
Yorodumi- EMDB-3277: Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage -
+Open data
-Basic information
Entry | Database: EMDB / ID: EMD-3277 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage | |||||||||
Map data | Reconstruction of Cas9 bound to sgRNA and 40-bp target DNA | |||||||||
Sample |
| |||||||||
Keywords | CRISPR-Cas / Cas9 / genome editing | |||||||||
Function / homology | Function and homology information : / maintenance of CRISPR repeat elements / 3'-5' exonuclease activity / DNA endonuclease activity / endonuclease activity / defense response to virus / Hydrolases; Acting on ester bonds / DNA binding / RNA binding / metal ion binding Similarity search - Function | |||||||||
Biological species | Streptococcus pyogenes (bacteria) / lambda (unknown) | |||||||||
Method | single particle reconstruction / cryo EM / Resolution: 6.0 Å | |||||||||
Authors | Jiang F / Taylor DW / Chen JS / Kornfeld JE / Zhou K / Thompson AJ / Nogales E / Doudna JA | |||||||||
Citation | Journal: Science / Year: 2016 Title: Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Authors: Fuguo Jiang / David W Taylor / Janice S Chen / Jack E Kornfeld / Kaihong Zhou / Aubri J Thompson / Eva Nogales / Jennifer A Doudna / Abstract: Bacterial adaptive immunity and genome engineering involving the CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) protein Cas9 begin with RNA-guided DNA unwinding ...Bacterial adaptive immunity and genome engineering involving the CRISPR (clustered regularly interspaced short palindromic repeats)-associated (Cas) protein Cas9 begin with RNA-guided DNA unwinding to form an RNA-DNA hybrid and a displaced DNA strand inside the protein. The role of this R-loop structure in positioning each DNA strand for cleavage by the two Cas9 nuclease domains is unknown. We determine molecular structures of the catalytically active Streptococcus pyogenes Cas9 R-loop that show the displaced DNA strand located near the RuvC nuclease domain active site. These protein-DNA interactions, in turn, position the HNH nuclease domain adjacent to the target DNA strand cleavage site in a conformation essential for concerted DNA cutting. Cas9 bends the DNA helix by 30°, providing the structural distortion needed for R-loop formation. | |||||||||
History |
|
-Structure visualization
Movie |
Movie viewer |
---|---|
Structure viewer | EM map: SurfViewMolmilJmol/JSmol |
Supplemental images |
-Downloads & links
-EMDB archive
Map data | emd_3277.map.gz | 84.7 MB | EMDB map data format | |
---|---|---|---|---|
Header (meta data) | emd-3277-v30.xml emd-3277.xml | 11.8 KB 11.8 KB | Display Display | EMDB header |
Images | emd_3277.png | 419.2 KB | ||
Archive directory | http://ftp.pdbj.org/pub/emdb/structures/EMD-3277 ftp://ftp.pdbj.org/pub/emdb/structures/EMD-3277 | HTTPS FTP |
-Validation report
Summary document | emd_3277_validation.pdf.gz | 241.1 KB | Display | EMDB validaton report |
---|---|---|---|---|
Full document | emd_3277_full_validation.pdf.gz | 240.2 KB | Display | |
Data in XML | emd_3277_validation.xml.gz | 6.2 KB | Display | |
Arichive directory | https://ftp.pdbj.org/pub/emdb/validation_reports/EMD-3277 ftp://ftp.pdbj.org/pub/emdb/validation_reports/EMD-3277 | HTTPS FTP |
-Related structure data
-Links
EMDB pages | EMDB (EBI/PDBe) / EMDataResource |
---|---|
Related items in Molecule of the Month |
-Map
File | Download / File: emd_3277.map.gz / Format: CCP4 / Size: 89 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Annotation | Reconstruction of Cas9 bound to sgRNA and 40-bp target DNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Voxel size | X=Y=Z: 1.01 Å | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Density |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Symmetry | Space group: 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Details | EMDB XML:
CCP4 map header:
|
-Supplemental data
-Sample components
-Entire : Cas9 bound to single guide-RNA and 40-bp target DNA
Entire | Name: Cas9 bound to single guide-RNA and 40-bp target DNA |
---|---|
Components |
|
-Supramolecule #1000: Cas9 bound to single guide-RNA and 40-bp target DNA
Supramolecule | Name: Cas9 bound to single guide-RNA and 40-bp target DNA / type: sample / ID: 1000 / Number unique components: 3 |
---|---|
Molecular weight | Theoretical: 218 KDa |
-Macromolecule #1: CRISPR-associated endonuclease Cas9/Csn1
Macromolecule | Name: CRISPR-associated endonuclease Cas9/Csn1 / type: protein_or_peptide / ID: 1 / Name.synonym: Cas9 / Number of copies: 1 / Oligomeric state: monomer / Recombinant expression: Yes |
---|---|
Source (natural) | Organism: Streptococcus pyogenes (bacteria) / Strain: serotype M1 |
Molecular weight | Theoretical: 158 KDa |
Recombinant expression | Organism: Escherichia coli (E. coli) / Recombinant strain: BL21 |
Sequence | UniProtKB: CRISPR-associated endonuclease Cas9/Csn1 GO: maintenance of CRISPR repeat elements, defense response to virus, GO: 0090305, DNA binding, RNA binding, endonuclease activity InterPro: CRISPR-associated endonuclease Cas9, CRISPR-associated endonuclease Cas9, bridge helix, CRISPR-associated endonuclease Cas9, PAM-interacting domain, CRISPR-associated endonuclease Cas9, REC ...InterPro: CRISPR-associated endonuclease Cas9, CRISPR-associated endonuclease Cas9, bridge helix, CRISPR-associated endonuclease Cas9, PAM-interacting domain, CRISPR-associated endonuclease Cas9, REC lobe, INTERPRO: IPR025978, HNH nuclease |
-Macromolecule #2: single guide-RNA
Macromolecule | Name: single guide-RNA / type: rna / ID: 2 / Name.synonym: sgRNA / Classification: OTHER / Structure: OTHER / Synthetic?: Yes |
---|---|
Source (natural) | Organism: Streptococcus pyogenes (bacteria) / Strain: serotype M1 |
Molecular weight | Theoretical: 36 KDa |
Sequence | String: GGCGCAUAAA GAUGAGACGC GUUUUAGAGC UAUGCUGUUU UGAAAAAAAC AGCAUAGCAA GUUAAAAUAA GGCUAGUCCG UUAUCAACUU GAAAAAGUGG CACCGAGUCG GUGCUUCG |
-Macromolecule #3: target 40-bp double stranded DNA
Macromolecule | Name: target 40-bp double stranded DNA / type: dna / ID: 3 / Name.synonym: dsDNA Details: complementary strand nucleotide sequence: CGTGTTGATGCCGCGTATTTCTACTCTGCGACCGCTAATC Classification: DNA / Structure: DOUBLE HELIX / Synthetic?: Yes |
---|---|
Source (natural) | Organism: lambda (unknown) / Strain: lambda 1 / synonym: lambda phage |
Molecular weight | Theoretical: 24 KDa |
Sequence | String: GCACAACTAC GGCGCATAAA GATGAGACGC TGGCGATTAG |
-Experimental details
-Structure determination
Method | cryo EM |
---|---|
Processing | single particle reconstruction |
Aggregation state | particle |
-Sample preparation
Concentration | 0.25 mg/mL |
---|---|
Buffer | pH: 8 Details: 30mM Tris 8.0, 150mM NaCl, 20mM EDTA, 5mM DTT and 0.1% glycerol |
Grid | Details: 4/2 C-flat grids with a thin-layer of carbon over the holes |
Vitrification | Cryogen name: ETHANE / Chamber humidity: 100 % / Chamber temperature: 100 K / Instrument: FEI VITROBOT MARK IV Method: Grids were rapidly plunged into liquid ethane using an FEI Vitrobot MarkIV maintained at 4 degrees C after being blotted for 4-4.5 seconds with a blotting force of 15-20. |
-Electron microscopy
Microscope | FEI TITAN KRIOS |
---|---|
Alignment procedure | Legacy - Astigmatism: Objective astigmatism was corrected at 210,000 times magnification |
Details | Data acquired using Leginon. We collected a 6 s exposure fractionated into 20, 300 ms frames with a dose of 8 electrons per square Angstrom per second. |
Date | Jun 29, 2015 |
Image recording | Category: CCD / Film or detector model: GATAN K2 SUMMIT (4k x 4k) / Number real images: 5600 / Average electron dose: 48 e/Å2 |
Electron beam | Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN |
Electron optics | Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 2.7 mm / Nominal defocus max: 4.5 µm / Nominal defocus min: 2.0 µm / Nominal magnification: 29000 |
Sample stage | Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
-Image processing
CTF correction | Details: CTFFind3 |
---|---|
Final reconstruction | Applied symmetry - Point group: C1 (asymmetric) / Algorithm: OTHER / Resolution.type: BY AUTHOR / Resolution: 6.0 Å / Resolution method: OTHER / Software - Name: Relion / Number images used: 50000 |