+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9yi8 | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Cryo-EM structure of yeast Mgm101 bound to apparent B-form DNA | |||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN/DNA / Single strand annealing protein / SSAP / annealase / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex | |||||||||||||||||||||||||||
| Function / homology | Function and homology informationmitochondrial chromosome / : / recombinational repair / mitochondrial nucleoid / interstrand cross-link repair / single-stranded DNA binding / DNA repair / mitochondrion / DNA binding Similarity search - Function | |||||||||||||||||||||||||||
| Biological species | ![]() Inovirus M13 | |||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.16 Å | |||||||||||||||||||||||||||
Authors | Wheat, C.T. / Bell, C.E. | |||||||||||||||||||||||||||
| Funding support | United States, 1items
| |||||||||||||||||||||||||||
Citation | Journal: To Be PublishedTitle: Mechanism of single-strand annealing from native mass spectrometry and cryo-EM structures of RAD52 homolog Mgm101 Authors: Wheat, C.T. / Bell, C.E. | |||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9yi8.cif.gz | 713.8 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9yi8.ent.gz | 589.4 KB | Display | PDB format |
| PDBx/mmJSON format | 9yi8.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Summary document | 9yi8_validation.pdf.gz | 1.8 MB | Display | wwPDB validaton report |
|---|---|---|---|---|
| Full document | 9yi8_full_validation.pdf.gz | 1.9 MB | Display | |
| Data in XML | 9yi8_validation.xml.gz | 113.8 KB | Display | |
| Data in CIF | 9yi8_validation.cif.gz | 162 KB | Display | |
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/yi/9yi8 ftp://data.pdbj.org/pub/pdb/validation_reports/yi/9yi8 | HTTPS FTP |
-Related structure data
| Related structure data | ![]() 72981MC ![]() 9yi6C ![]() 9yi7C ![]() 9yi9C ![]() 9yiaC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
| Experimental dataset #1 | Data reference: 10.6019/EMPIAR-13025 / Data set type: EMPIAR / Metadata reference: 10.6019/EMPIAR-13025 |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
| #1: DNA chain | Mass: 6258.394 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: The actual sequence is: TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAA Source: (synth.) Inovirus M13 | ||
|---|---|---|---|
| #2: DNA chain | Mass: 6618.585 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: The actual sequence is: TTAAAACATGTTGAGCTACAGCACCAGATTCAGCAATTAAGCTCTAAGCCATCCGCAAAAATGACCTCTTATCAA Source: (synth.) Inovirus M13 | ||
| #3: Protein | Mass: 28524.535 Da / Num. of mol.: 19 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: MGM101, MGM9, YJR144W, J2181 / Production host: ![]() Has protein modification | N | |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: Cryo-EM structure of yeast Mgm101 bound to apparent B-form DNA Type: COMPLEX / Entity ID: all / Source: RECOMBINANT |
|---|---|
| Molecular weight | Value: 0.587 MDa / Experimental value: YES |
| Source (natural) | Organism: ![]() |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: TFS KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: SPOT SCAN |
| Electron lens | Mode: BRIGHT FIELD / Nominal magnification: 81000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm / Cs: 0.01 mm / C2 aperture diameter: 50 µm |
| Image recording | Average exposure time: 2.6 sec. / Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of grids imaged: 1 |
| EM imaging optics | Energyfilter name: GIF Bioquantum / Energyfilter slit width: 20 eV |
-
Processing
| EM software |
| ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.16 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 40203 / Symmetry type: POINT |
Movie
Controller
About Yorodumi





Inovirus M13
United States, 1items
Citation








PDBj









































FIELD EMISSION GUN