[English] 日本語
Yorodumi
- PDB-9p9h: In situ human unrotated hibernating with CCDC124 state 80S ribosome -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9p9h
TitleIn situ human unrotated hibernating with CCDC124 state 80S ribosome
Components
  • (40S ribosomal protein ...) x 19
  • (60S ribosomal protein ...) x 33
  • (Large ribosomal subunit protein ...) x 7
  • (Ribosomal protein ...) x 2
  • (Small ribosomal subunit protein ...) x 12
  • 18S rRNA
  • 28S rRNA
  • 5.8S rRNA
  • 5S rRNA
  • 60S acidic ribosomal protein P0
  • Coiled-coil domain-containing protein 124
  • E site tRNA
  • Elongation factor 2
  • Heparin-binding protein HBp15
  • Receptor of activated protein C kinase 1
  • Transcription factor BTF3
  • Ubiquitin-40S ribosomal protein S27a
KeywordsRIBOSOME / In situ
Function / homology
Function and homology information


Synthesis of diphthamide-EEF2 / translation at postsynapse / negative regulation of protein localization to endoplasmic reticulum / nascent polypeptide-associated complex / response to folic acid / positive regulation of cytoplasmic translation / response to insecticide / eukaryotic 80S initiation complex / regulation of translation involved in cellular response to UV / negative regulation of formation of translation preinitiation complex ...Synthesis of diphthamide-EEF2 / translation at postsynapse / negative regulation of protein localization to endoplasmic reticulum / nascent polypeptide-associated complex / response to folic acid / positive regulation of cytoplasmic translation / response to insecticide / eukaryotic 80S initiation complex / regulation of translation involved in cellular response to UV / negative regulation of formation of translation preinitiation complex / axial mesoderm development / regulation of G1 to G0 transition / negative regulation of endoplasmic reticulum unfolded protein response / ribosomal protein import into nucleus / oxidized pyrimidine DNA binding / response to TNF agonist / positive regulation of base-excision repair / protein-DNA complex disassembly / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator / positive regulation of respiratory burst involved in inflammatory response / positive regulation of gastrulation / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage / protein tyrosine kinase inhibitor activity / positive regulation of ubiquitin-protein transferase activity / 90S preribosome assembly / IRE1-RACK1-PP2A complex / positive regulation of Golgi to plasma membrane protein transport / nucleolus organization / aggresome / positive regulation of DNA-templated transcription initiation / TNFR1-mediated ceramide production / GAIT complex / negative regulation of RNA splicing / positive regulation of DNA damage response, signal transduction by p53 class mediator / TORC2 complex binding / supercoiled DNA binding / neural crest cell differentiation / NF-kappaB complex / negative regulation of DNA repair / G1 to G0 transition / oxidized purine DNA binding / cytoplasmic translational initiation / cysteine-type endopeptidase activator activity involved in apoptotic process / middle ear morphogenesis / regulation of establishment of cell polarity / negative regulation of intrinsic apoptotic signaling pathway in response to hydrogen peroxide / negative regulation of bicellular tight junction assembly / ubiquitin-like protein conjugating enzyme binding / rRNA modification in the nucleus and cytosol / negative regulation of phagocytosis / erythrocyte homeostasis / Formation of the ternary complex, and subsequently, the 43S complex / cytoplasmic side of rough endoplasmic reticulum membrane / Uptake and function of diphtheria toxin / protein kinase A binding / lncRNA binding / ion channel inhibitor activity / Ribosomal scanning and start codon recognition / laminin receptor activity / homeostatic process / pigmentation / Translation initiation complex formation / positive regulation of mitochondrial depolarization / macrophage chemotaxis / lung morphogenesis / negative regulation of Wnt signaling pathway / positive regulation of natural killer cell proliferation / fibroblast growth factor binding / male meiosis I / monocyte chemotaxis / BH3 domain binding / negative regulation of translational frameshifting / TOR signaling / Protein hydroxylation / SARS-CoV-1 modulates host translation machinery / regulation of adenylate cyclase-activating G protein-coupled receptor signaling pathway / iron-sulfur cluster binding / mTORC1-mediated signalling / positive regulation of GTPase activity / Peptide chain elongation / regulation of cell division / skeletal muscle cell differentiation / Selenocysteine synthesis / cellular response to ethanol / Formation of a pool of free 40S subunits / translational elongation / blastocyst development / positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator / Eukaryotic Translation Termination / protein serine/threonine kinase inhibitor activity / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / negative regulation of protein binding / Viral mRNA Translation / ubiquitin ligase inhibitor activity / negative regulation of respiratory burst involved in inflammatory response / Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) / endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / positive regulation of signal transduction by p53 class mediator / protein localization to nucleus
Similarity search - Function
Coiled-coil domain-containing protein 124/Oxs1 / : / Coiled-coil domain-containing protein 124 /Oxs1 / Transcription factor BTF3 / Nascent polypeptide-associated complex NAC domain / NAC A/B domain superfamily / NAC domain / NAC A/B domain profile. / NAC / 60s Acidic ribosomal protein ...Coiled-coil domain-containing protein 124/Oxs1 / : / Coiled-coil domain-containing protein 124 /Oxs1 / Transcription factor BTF3 / Nascent polypeptide-associated complex NAC domain / NAC A/B domain superfamily / NAC domain / NAC A/B domain profile. / NAC / 60s Acidic ribosomal protein / 60S acidic ribosomal protein P0 / : / Elongation Factor G, domain II / Elongation Factor G, domain III / 40S ribosomal protein SA / Translation elongation factor EFG/EF2, domain IV / Elongation factor G, domain IV / Elongation factor G, domain IV / Elongation factor G C-terminus / Ribosomal protein L6, N-terminal / 40S ribosomal protein SA, C-terminal domain / Ribosomal protein L6, N-terminal domain / 40S ribosomal protein SA C-terminus / Ubiquitin-like protein FUBI / Elongation factor EFG, domain V-like / Elongation factor G C-terminus / 50S ribosomal protein L10, insertion domain superfamily / Ribosomal protein L30e / EF-G domain III/V-like / Ribosomal L15/L27a, N-terminal / Ribosomal protein L28e / 60S ribosomal protein L10P, insertion domain / Insertion domain in 60S ribosomal protein L10P / : / Tr-type G domain, conserved site / Translational (tr)-type guanine nucleotide-binding (G) domain signature. / Ribosomal protein L23 / Ribosomal protein L2, archaeal-type / Ribosomal L28e/Mak16 / Ribosomal L28e protein family / metallochaperone-like domain / TRASH domain / : / Ribosomal protein S26e signature. / Ribosomal protein L41 / Ribosomal protein L41 / Ribosomal protein S21e, conserved site / Ribosomal protein S21e signature. / Ribosomal protein L13e, conserved site / Ribosomal protein L13e signature. / : / Ribosomal protein S12e signature. / Ribosomal protein S26e / Ribosomal protein S26e superfamily / Ribosomal protein S26e / Ribosomal protein S12e / Ribosomal protein L29e / Ribosomal L29e protein family / Translation elongation factor EFTu-like, domain 2 / Small (40S) ribosomal subunit Asc1/RACK1 / Ribosomal protein S5, eukaryotic/archaeal / Ribosomal protein L27e, conserved site / Ribosomal protein L27e signature. / Ribosomal protein L22e / Ribosomal protein L22e superfamily / Ribosomal L22e protein family / Ribosomal protein L13e / Ribosomal protein S21e / Ribosomal protein S21e superfamily / Ribosomal protein S21e / Ribosomal protein L13e / Ribosomal protein S2, eukaryotic / Ribosomal protein S19e, conserved site / Ribosomal protein S19e signature. / Ribosomal protein L38e / Ribosomal protein L38e superfamily / Ribosomal L38e protein family / Ribosomal protein L19, eukaryotic / S27a-like superfamily / Ribosomal protein L10e, conserved site / : / Ribosomal protein L10e signature. / Ribosomal protein L6e signature. / Ribosomal protein L44e signature. / Ribosomal protein L19/L19e conserved site / Ribosomal protein L19e signature. / 40S Ribosomal protein S10 / 60S ribosomal protein L18a/ L20, eukaryotes / Ribosomal protein L10e / Ribosomal protein L24e, conserved site / Ribosomal protein L24e signature. / Elongation factor Tu domain 2 / Plectin/S10, N-terminal / Ribosomal protein L18/L18-A/B/e, conserved site / Plectin/S10 domain / Ribosomal protein L18e signature. / Ribosomal protein L34e, conserved site / Ribosomal protein L34e signature. / Ribosomal protein L5 eukaryotic, C-terminal / Ribosomal L18 C-terminal region
Similarity search - Domain/homology
SPERMIDINE / SPERMINE / : / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Large ribosomal subunit protein eL24 / Large ribosomal subunit protein uL10 ...SPERMIDINE / SPERMINE / : / : / RNA / RNA (> 10) / RNA (> 100) / RNA (> 1000) / Large ribosomal subunit protein eL24 / Large ribosomal subunit protein uL10 / Small ribosomal subunit protein eS17 / Small ribosomal subunit protein uS2 / Elongation factor 2 / Small ribosomal subunit protein uS5 / Large ribosomal subunit protein eL33 / Large ribosomal subunit protein uL30 / Large ribosomal subunit protein uL22 / Transcription factor BTF3 / Small ribosomal subunit protein uS3 / Small ribosomal subunit protein eS12 / Large ribosomal subunit protein eL13 / Large ribosomal subunit protein uL11 / Large ribosomal subunit protein uL6 / Large ribosomal subunit protein uL4 / Small ribosomal subunit protein eS19 / Large ribosomal subunit protein uL3 / Large ribosomal subunit protein uL13 / Small ribosomal subunit protein eS27 / Large ribosomal subunit protein uL29 / Large ribosomal subunit protein uL15 / Large ribosomal subunit protein uL18 / Large ribosomal subunit protein eL21 / Large ribosomal subunit protein eL28 / Small ribosomal subunit protein uS4 / Small ribosomal subunit protein uS7 / Small ribosomal subunit protein eS10 / Large ribosomal subunit protein eL29 / Large ribosomal subunit protein eL34 / Large ribosomal subunit protein eL14 / Small ribosomal subunit protein uS10 / Small ribosomal subunit protein eS1 / Large ribosomal subunit protein uL24 / Large ribosomal subunit protein eL15 / Large ribosomal subunit protein eL27 / Large ribosomal subunit protein eL43 / Large ribosomal subunit protein eL37 / Small ribosomal subunit protein eS7 / Small ribosomal subunit protein eS8 / Small ribosomal subunit protein uS8 / Small ribosomal subunit protein uS9 / Small ribosomal subunit protein uS11 / Small ribosomal subunit protein uS12 / Small ribosomal subunit protein uS13 / Small ribosomal subunit protein uS14 / Small ribosomal subunit protein uS15 / Small ribosomal subunit protein uS17 / Large ribosomal subunit protein eL8 / Small ribosomal subunit protein eS4, X isoform / Large ribosomal subunit protein uL23 / Small ribosomal subunit protein eS6 / Large ribosomal subunit protein uL14 / Small ribosomal subunit protein uS19 / Small ribosomal subunit protein eS24 / Small ribosomal subunit protein eS25 / Small ribosomal subunit protein eS26 / Small ribosomal subunit protein eS28 / Ubiquitin-like FUBI-ribosomal protein eS30 fusion protein / Large ribosomal subunit protein eL30 / Large ribosomal subunit protein eL39 / Large ribosomal subunit protein eL31 / Large ribosomal subunit protein eL32 / Large ribosomal subunit protein uL5 / Large ribosomal subunit protein uL2 / Small ribosomal subunit protein eS32 / Ubiquitin-ribosomal protein eS31 fusion protein / Ubiquitin-ribosomal protein eL40 fusion protein / Large ribosomal subunit protein eL38 / Small ribosomal subunit protein eS21 / Small ribosomal subunit protein RACK1 / Large ribosomal subunit protein eL42 / Large ribosomal subunit protein eL19 / Large ribosomal subunit protein eL20 / Large ribosomal subunit protein eL6 / Large ribosomal subunit protein eL18 / Large ribosomal subunit protein eL22 / Coiled-coil domain-containing protein 124 / Ribosomal protein uL16-like / Large ribosomal subunit protein eL36
Similarity search - Component
Biological speciesHomo sapiens (human)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.84 Å
AuthorsWei, Z. / Yong, X.
Funding support1items
OrganizationGrant numberCountry
Not funded
CitationJournal: Nat Commun / Year: 2025
Title: Visualizing the translation landscape in human cells at high resolution.
Authors: Wei Zheng / Yuekang Zhang / Jimin Wang / Shuhui Wang / Pengxin Chai / Elizabeth J Bailey / Chenghao Zhu / Wangbiao Guo / Swapnil C Devarkar / Shenping Wu / Jianfeng Lin / Kai Zhang / Jun Liu ...Authors: Wei Zheng / Yuekang Zhang / Jimin Wang / Shuhui Wang / Pengxin Chai / Elizabeth J Bailey / Chenghao Zhu / Wangbiao Guo / Swapnil C Devarkar / Shenping Wu / Jianfeng Lin / Kai Zhang / Jun Liu / Ivan B Lomakin / Yong Xiong /
Abstract: Comprehensive in situ structures of macromolecules can transform our understanding of biology and advance human health. Here, we map protein synthesis inside human cells in detail by combining ...Comprehensive in situ structures of macromolecules can transform our understanding of biology and advance human health. Here, we map protein synthesis inside human cells in detail by combining automated cryo-focused ion beam (FIB) milling and in situ single-particle cryo electron microscopy (cryo-EM). With this in situ cryo-EM approach, we resolved a 2.2 Å consensus structure of the human 80S ribosome and unveiled 23 functional states, nearly all better than 3 Å resolution. Compared to in vitro studies, we observed variations in ribosome structures, distinct environments of ion and polyamine binding, and associated proteins such as EDF1 and NACβ that are typically not enriched with purified ribosomes. We also detected additional peptide-related density features on the ribosome and visualized ribosome-ribosome interactions in helical polysomes. Finally, high-resolution structures from cells treated with homoharringtonine and cycloheximide revealed a distinct translational landscape and a spermidine that interacts with cycloheximide at the E site, one of the numerous polyamines that also bind native ribosomes. These results underscore the value of high-resolution in situ studies in the native environment.
History
DepositionJun 24, 2025Deposition site: RCSB / Processing site: RCSB
SupersessionDec 24, 2025ID: 9B0J
Revision 1.0Dec 24, 2025Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Dec 24, 2025Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
CI: Transcription factor BTF3
L5: 28S rRNA
L7: 5S rRNA
L8: 5.8S rRNA
LA: 60S ribosomal protein L8
LB: Large ribosomal subunit protein uL3
LC: 60S ribosomal protein L4
LD: Large ribosomal subunit protein uL18
LE: Large ribosomal subunit protein eL6
LF: 60S ribosomal protein L7
LG: 60S ribosomal protein L7a
LH: 60S ribosomal protein L9
LI: Ribosomal protein uL16-like
LJ: 60S ribosomal protein L11
LL: Large ribosomal subunit protein eL13
LM: 60S ribosomal protein L14
LN: 60S ribosomal protein L15
LO: 60S ribosomal protein L13a
LP: 60S ribosomal protein L17
LQ: 60S ribosomal protein L18
LR: 60S ribosomal protein L19
LS: 60S ribosomal protein L18a
LT: 60S ribosomal protein L21
LU: Heparin-binding protein HBp15
LV: 60S ribosomal protein L23
LW: Ribosomal protein L24
LX: 60S ribosomal protein L23a
LY: 60S ribosomal protein L26
LZ: 60S ribosomal protein L27
La: 60S ribosomal protein L27a
Lb: Large ribosomal subunit protein eL29
Lc: 60S ribosomal protein L30
Ld: 60S ribosomal protein L31
Le: 60S ribosomal protein L32
Lf: 60S ribosomal protein L35a
Lg: 60S ribosomal protein L34
Lh: 60S ribosomal protein L35
Li: 60S ribosomal protein L36
Lj: 60S ribosomal protein L37
Lk: 60S ribosomal protein L38
Ll: 60S ribosomal protein L39
Lm: Large ribosomal subunit protein eL40
Ln: 60S ribosomal protein L41
Lo: 60S ribosomal protein L36a
Lp: 60S ribosomal protein L37a
Lr: 60S ribosomal protein L28
Ls: 60S acidic ribosomal protein P0
Lt: Large ribosomal subunit protein uL11
SD: Small ribosomal subunit protein uS3
SF: 40S ribosomal protein S5
SK: 40S ribosomal protein S10
SM: Small ribosomal subunit protein eS12
SP: Small ribosomal subunit protein uS19
SQ: Small ribosomal subunit protein uS9
SR: Small ribosomal subunit protein eS17
SS: 40S ribosomal protein S18
ST: 40S ribosomal protein S19
SU: 40S ribosomal protein S20
SZ: Small ribosomal subunit protein eS25
Sc: 40S ribosomal protein S28
Sd: 40S ribosomal protein S29
Sf: Ubiquitin-40S ribosomal protein S27a
Sg: Receptor of activated protein C kinase 1
SA: 40S ribosomal protein SA
SB: 40S ribosomal protein S3a
SC: 40S ribosomal protein S2
SE: Small ribosomal subunit protein eS4, X isoform
SG: 40S ribosomal protein S6
SH: Small ribosomal subunit protein eS7
SI: 40S ribosomal protein S8
SJ: 40S ribosomal protein S9
SL: 40S ribosomal protein S11
SN: 40S ribosomal protein S13
SO: Small ribosomal subunit protein uS11
SV: Small ribosomal subunit protein eS21
SW: 40S ribosomal protein S15a
SX: 40S ribosomal protein S23
SY: 40S ribosomal protein S24
Sa: 40S ribosomal protein S26
Sb: Small ribosomal subunit protein eS27
Se: Small ribosomal subunit protein eS30
S2: 18S rRNA
CB: Elongation factor 2
Et: E site tRNA
CE: Coiled-coil domain-containing protein 124
hetero molecules


Theoretical massNumber of molelcules
Total (without water)3,343,535327
Polymers3,334,95185
Non-polymers8,584242
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Protein/peptide , 1 types, 1 molecules CI

#1: Protein/peptide Transcription factor BTF3 / Nascent polypeptide-associated complex subunit beta / NAC-beta / RNA polymerase B transcription factor 3


Mass: 3554.331 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P20290

-
RNA chain , 5 types, 5 molecules L5L7L8S2Et

#2: RNA chain 28S rRNA


Mass: 1191482.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)
#3: RNA chain 5S rRNA


Mass: 38691.914 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: GenBank: 23898
#4: RNA chain 5.8S rRNA


Mass: 50157.676 Da / Num. of mol.: 1 / Source method: isolated from a natural source
Details: CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGC(PSU)GCGAGAAUUAAUG(PSU)GAA UU(OMG)CAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGA GCGUCGCU
Source: (natural) Homo sapiens (human) / References: GenBank: 2795773355
#82: RNA chain 18S rRNA


Mass: 562093.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)
#84: RNA chain E site tRNA


Mass: 24298.369 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)

+
60S ribosomal protein ... , 33 types, 33 molecules LALCLFLGLHLJLMLNLOLPLQLRLSLTLVLXLYLZLaLcLdLeLfLgLhLiLjLkLlLn...

#5: Protein 60S ribosomal protein L8 / Large ribosomal subunit protein uL2


Mass: 26998.613 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62917
#7: Protein 60S ribosomal protein L4 / 60S ribosomal protein L1 / Large ribosomal subunit protein uL4


Mass: 41747.203 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P36578
#10: Protein 60S ribosomal protein L7 / Large ribosomal subunit protein uL30


Mass: 26590.725 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18124
#11: Protein 60S ribosomal protein L7a / Large ribosomal subunit protein eL8 / PLA-X polypeptide / Surfeit locus protein 3


Mass: 27452.500 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62424
#12: Protein 60S ribosomal protein L9 / Large ribosomal subunit protein uL6


Mass: 21655.268 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P32969
#14: Protein 60S ribosomal protein L11 / CLL-associated antigen KW-12 / Large ribosomal subunit protein uL5


Mass: 20086.191 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62913
#16: Protein 60S ribosomal protein L14 / CAG-ISL 7 / Large ribosomal subunit protein eL14


Mass: 16220.309 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P50914
#17: Protein 60S ribosomal protein L15 / Large ribosomal subunit protein eL15


Mass: 24076.088 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61313
#18: Protein 60S ribosomal protein L13a / 23 kDa highly basic protein / Large ribosomal subunit protein uL13


Mass: 23431.139 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P40429
#19: Protein 60S ribosomal protein L17 / 60S ribosomal protein L23 / Large ribosomal subunit protein uL22 / PD-1


Mass: 17757.627 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18621
#20: Protein 60S ribosomal protein L18 / Large ribosomal subunit protein eL18


Mass: 21556.482 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q07020
#21: Protein 60S ribosomal protein L19 / Large ribosomal subunit protein eL19


Mass: 22441.021 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P84098
#22: Protein 60S ribosomal protein L18a / Large ribosomal subunit protein eL20


Mass: 20677.316 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q02543
#23: Protein 60S ribosomal protein L21 / Large ribosomal subunit protein eL21


Mass: 18478.791 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46778
#25: Protein 60S ribosomal protein L23 / 60S ribosomal protein L17 / Large ribosomal subunit protein uL14


Mass: 13972.425 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62829
#27: Protein 60S ribosomal protein L23a / Large ribosomal subunit protein uL23


Mass: 13985.541 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62750
#28: Protein 60S ribosomal protein L26 / Large ribosomal subunit protein uL24


Mass: 15891.787 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61254
#29: Protein 60S ribosomal protein L27 / Large ribosomal subunit protein eL27


Mass: 15704.635 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61353
#30: Protein 60S ribosomal protein L27a / Large ribosomal subunit protein uL15


Mass: 16473.340 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46776
#32: Protein 60S ribosomal protein L30 / Large ribosomal subunit protein eL30


Mass: 10954.884 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62888
#33: Protein 60S ribosomal protein L31 / Large ribosomal subunit protein eL31


Mass: 12635.694 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62899
#34: Protein 60S ribosomal protein L32 / Large ribosomal subunit protein eL32


Mass: 15022.021 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62910
#35: Protein 60S ribosomal protein L35a / Cell growth-inhibiting gene 33 protein / Large ribosomal subunit protein eL33


Mass: 12433.548 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P18077
#36: Protein 60S ribosomal protein L34 / Large ribosomal subunit protein eL34


Mass: 12994.621 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P49207
#37: Protein 60S ribosomal protein L35 / Large ribosomal subunit protein uL29


Mass: 14462.429 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P42766
#38: Protein 60S ribosomal protein L36 / Large ribosomal subunit protein eL36


Mass: 11915.396 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q9Y3U8
#39: Protein 60S ribosomal protein L37 / G1.16 / Large ribosomal subunit protein eL37


Mass: 10090.891 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61927
#40: Protein 60S ribosomal protein L38 / Large ribosomal subunit protein eL38


Mass: 8107.752 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63173
#41: Protein/peptide 60S ribosomal protein L39 / Large ribosomal subunit protein eL39


Mass: 6295.562 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62891
#43: Protein/peptide 60S ribosomal protein L41 / HG12 / Large ribosomal subunit protein eL41


Mass: 3344.271 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62945
#44: Protein 60S ribosomal protein L36a / 60S ribosomal protein L44 / Cell growth-inhibiting gene 15 protein / Cell migration-inducing gene 6 ...60S ribosomal protein L44 / Cell growth-inhibiting gene 15 protein / Cell migration-inducing gene 6 protein / Large ribosomal subunit protein eL42


Mass: 12345.776 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P83881
#45: Protein 60S ribosomal protein L37a / Large ribosomal subunit protein eL43


Mass: 10168.153 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61513
#46: Protein 60S ribosomal protein L28 / Large ribosomal subunit protein eL28


Mass: 14320.824 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46779

-
Large ribosomal subunit protein ... , 7 types, 7 molecules LBLDLELLLbLmLt

#6: Protein Large ribosomal subunit protein uL3


Mass: 46079.918 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P39023
#8: Protein Large ribosomal subunit protein uL18


Mass: 34008.324 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46777
#9: Protein Large ribosomal subunit protein eL6 / 60S ribosomal protein L6 / Neoplasm-related protein C140 / Tax-responsive enhancer element-binding ...60S ribosomal protein L6 / Neoplasm-related protein C140 / Tax-responsive enhancer element-binding protein 107 / TaxREB107


Mass: 28694.230 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q02878
#15: Protein Large ribosomal subunit protein eL13


Mass: 24190.484 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P26373
#31: Protein Large ribosomal subunit protein eL29 / 60S ribosomal protein L29 / Cell surface heparin-binding protein HIP


Mass: 13965.825 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P47914
#42: Protein Large ribosomal subunit protein eL40 / 60S ribosomal protein L40


Mass: 6199.574 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62987
#48: Protein Large ribosomal subunit protein uL11 / 60S ribosomal protein L12


Mass: 16972.596 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P30050

-
Ribosomal protein ... , 2 types, 2 molecules LILW

#13: Protein Ribosomal protein uL16-like / 60S ribosomal protein L10-like / Large ribosomal subunit protein uL16-like


Mass: 24439.754 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q96L21
#26: Protein Ribosomal protein L24


Mass: 14476.975 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: A0A994J4A5

-
Protein , 6 types, 6 molecules LULsSfSgCBCE

#24: Protein Heparin-binding protein HBp15


Mass: 11722.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q7Z4W8
#47: Protein 60S acidic ribosomal protein P0 / 60S ribosomal protein L10E / Large ribosomal subunit protein uL10


Mass: 21507.035 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P05388
#62: Protein Ubiquitin-40S ribosomal protein S27a / Ubiquitin carboxyl extension protein 80


Mass: 7884.286 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62979
#63: Protein Receptor of activated protein C kinase 1 / Cell proliferation-inducing gene 21 protein / Guanine nucleotide-binding protein subunit beta-2- ...Cell proliferation-inducing gene 21 protein / Guanine nucleotide-binding protein subunit beta-2-like 1 / Guanine nucleotide-binding protein subunit beta-like protein 12.3 / Human lung cancer oncogene 7 protein / HLC-7 / Receptor for activated C kinase / Small ribosomal subunit protein RACK1


Mass: 34669.113 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63244
#83: Protein Elongation factor 2 / EF-2


Mass: 95232.875 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)
References: UniProt: P13639, Hydrolases; Acting on acid anhydrides; Acting on GTP to facilitate cellular and subcellular movement
#85: Protein Coiled-coil domain-containing protein 124


Mass: 8777.895 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q96CT7

-
Small ribosomal subunit protein ... , 12 types, 12 molecules SDSMSPSQSRSZSESHSOSVSbSe

#49: Protein Small ribosomal subunit protein uS3


Mass: 25172.561 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P23396
#52: Protein Small ribosomal subunit protein eS12 / 40S ribosomal protein S12


Mass: 13652.019 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P25398
#53: Protein Small ribosomal subunit protein uS19 / 40S ribosomal protein S15 / RIG protein


Mass: 14092.600 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62841
#54: Protein Small ribosomal subunit protein uS9 / 40S ribosomal protein S16


Mass: 16249.062 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62249
#55: Protein Small ribosomal subunit protein eS17 / 40S ribosomal protein S17


Mass: 15578.156 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P08708
#59: Protein Small ribosomal subunit protein eS25 / 40S ribosomal protein S25


Mass: 8526.119 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62851
#67: Protein Small ribosomal subunit protein eS4, X isoform / 40S ribosomal protein S4 / SCR10 / Single copy abundant mRNA protein


Mass: 29523.674 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62701
#69: Protein Small ribosomal subunit protein eS7 / 40S ribosomal protein S7


Mass: 21603.229 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62081
#74: Protein Small ribosomal subunit protein uS11 / 40S ribosomal protein S14


Mass: 15014.187 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62263
#75: Protein Small ribosomal subunit protein eS21 / 40S ribosomal protein S21


Mass: 9124.389 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63220
#80: Protein Small ribosomal subunit protein eS27 / 40S ribosomal protein S27 / Metallopan-stimulin 1 / MPS-1


Mass: 9348.990 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P42677
#81: Protein Small ribosomal subunit protein eS30 / 40S ribosomal protein S30


Mass: 6539.758 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62861

-
40S ribosomal protein ... , 19 types, 19 molecules SFSKSSSTSUScSdSASBSCSGSISJSLSNSWSXSYSa

#50: Protein 40S ribosomal protein S5 / Small ribosomal subunit protein uS7


Mass: 21327.723 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46782
#51: Protein 40S ribosomal protein S10 / Small ribosomal subunit protein eS10


Mass: 11773.953 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46783
#56: Protein 40S ribosomal protein S18 / Ke-3 / Ke3 / Small ribosomal subunit protein uS13


Mass: 17029.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62269
#57: Protein 40S ribosomal protein S19 / Small ribosomal subunit protein eS19


Mass: 15822.219 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P39019
#58: Protein 40S ribosomal protein S20 / Small ribosomal subunit protein uS10


Mass: 11765.890 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P60866
#60: Protein 40S ribosomal protein S28 / Small ribosomal subunit protein eS28


Mass: 7263.394 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62857
#61: Protein 40S ribosomal protein S29 / Small ribosomal subunit protein uS14


Mass: 6559.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62273
#64: Protein 40S ribosomal protein SA / 37 kDa laminin receptor precursor / 37LRP / 37/67 kDa laminin receptor / LRP/LR / 67 kDa laminin ...37 kDa laminin receptor precursor / 37LRP / 37/67 kDa laminin receptor / LRP/LR / 67 kDa laminin receptor / 67LR / Colon carcinoma laminin-binding protein / Laminin receptor 1 / LamR / Laminin-binding protein precursor p40 / LBP/p40 / Multidrug resistance-associated protein MGr1-Ag / NEM/1CHD4 / Small ribosomal subunit protein uS2


Mass: 24774.365 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P08865
#65: Protein 40S ribosomal protein S3a / Small ribosomal subunit protein eS1 / v-fos transformation effector protein / Fte-1


Mass: 24888.258 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61247
#66: Protein 40S ribosomal protein S2 / 40S ribosomal protein S4 / Protein LLRep3 / Small ribosomal subunit protein uS5


Mass: 24587.029 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P15880
#68: Protein 40S ribosomal protein S6 / Phosphoprotein NP33 / Small ribosomal subunit protein eS6


Mass: 27471.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62753
#70: Protein 40S ribosomal protein S8 / Small ribosomal subunit protein eS8


Mass: 24003.012 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62241
#71: Protein 40S ribosomal protein S9 / Small ribosomal subunit protein uS4


Mass: 21649.633 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46781
#72: Protein 40S ribosomal protein S11 / Small ribosomal subunit protein uS17


Mass: 17785.971 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62280
#73: Protein 40S ribosomal protein S13 / Small ribosomal subunit protein uS15


Mass: 17128.191 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62277
#76: Protein 40S ribosomal protein S15a / Small ribosomal subunit protein uS8


Mass: 14734.357 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62244
#77: Protein 40S ribosomal protein S23 / Small ribosomal subunit protein uS12


Mass: 15626.392 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62266
#78: Protein 40S ribosomal protein S24 / Small ribosomal subunit protein eS24


Mass: 15203.022 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62847
#79: Protein 40S ribosomal protein S26 / Small ribosomal subunit protein eS26


Mass: 11742.908 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62854

-
Non-polymers , 4 types, 242 molecules

#86: Chemical...
ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 219 / Source method: obtained synthetically / Formula: Mg / Feature type: SUBJECT OF INVESTIGATION
#87: Chemical
ChemComp-SPM / SPERMINE


Mass: 202.340 Da / Num. of mol.: 7 / Source method: obtained synthetically / Formula: C10H26N4 / Feature type: SUBJECT OF INVESTIGATION
#88: Chemical
ChemComp-SPD / SPERMIDINE / N-(2-AMINO-PROPYL)-1,4-DIAMINOBUTANE / PA(34)


Mass: 145.246 Da / Num. of mol.: 10 / Source method: obtained synthetically / Formula: C7H19N3 / Feature type: SUBJECT OF INVESTIGATION
#89: Chemical
ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 6 / Source method: obtained synthetically / Formula: Zn / Feature type: SUBJECT OF INVESTIGATION

-
Details

Has ligand of interestY
Has protein modificationY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: CELL / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: In situ human unrotated hibernating with CCDC124 state 80S ribosome
Type: RIBOSOME / Entity ID: #1-#85 / Source: NATURAL
Source (natural)Organism: Homo sapiens (human)
Buffer solutionpH: 7.4
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Tecnai F30 / Image courtesy: FEI Company
MicroscopyModel: FEI TECNAI F30
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 1200 nm
Image recordingElectron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k)

-
Processing

EM software
IDNameVersionCategory
1cryoSPARCparticle selection
2PHENIX1.20.1_4487:model refinement
13cryoSPARC3D reconstruction
CTF correctionType: NONE
3D reconstructionResolution: 2.84 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 86934 / Symmetry type: POINT

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more