[English] 日本語
Yorodumi- PDB-9p9h: In situ human unrotated hibernating with CCDC124 state 80S ribosome -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 9p9h | |||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | In situ human unrotated hibernating with CCDC124 state 80S ribosome | |||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||
Keywords | RIBOSOME / In situ | |||||||||||||||||||||||||||
| Function / homology | Function and homology informationSynthesis of diphthamide-EEF2 / translation at postsynapse / negative regulation of protein localization to endoplasmic reticulum / nascent polypeptide-associated complex / response to folic acid / response to insecticide / eukaryotic 80S initiation complex / positive regulation of cytoplasmic translation / regulation of translation involved in cellular response to UV / negative regulation of protein neddylation ...Synthesis of diphthamide-EEF2 / translation at postsynapse / negative regulation of protein localization to endoplasmic reticulum / nascent polypeptide-associated complex / response to folic acid / response to insecticide / eukaryotic 80S initiation complex / positive regulation of cytoplasmic translation / regulation of translation involved in cellular response to UV / negative regulation of protein neddylation / axial mesoderm development / negative regulation of formation of translation preinitiation complex / regulation of G1 to G0 transition / oxidized pyrimidine DNA binding / response to TNF agonist / negative regulation of endoplasmic reticulum unfolded protein response / positive regulation of base-excision repair / ribosomal protein import into nucleus / protein-DNA complex disassembly / positive regulation of respiratory burst involved in inflammatory response / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage / positive regulation of gastrulation / 90S preribosome assembly / protein tyrosine kinase inhibitor activity / positive regulation of endodeoxyribonuclease activity / nucleolus organization / IRE1-RACK1-PP2A complex / positive regulation of Golgi to plasma membrane protein transport / TNFR1-mediated ceramide production / negative regulation of DNA repair / negative regulation of RNA splicing / GAIT complex / positive regulation of DNA damage response, signal transduction by p53 class mediator / aggresome / TORC2 complex binding / G1 to G0 transition / supercoiled DNA binding / NF-kappaB complex / cysteine-type endopeptidase activator activity involved in apoptotic process / neural crest cell differentiation / oxidized purine DNA binding / middle ear morphogenesis / positive regulation of ubiquitin-protein transferase activity / negative regulation of intrinsic apoptotic signaling pathway in response to hydrogen peroxide / negative regulation of bicellular tight junction assembly / regulation of establishment of cell polarity / ubiquitin-like protein conjugating enzyme binding / rRNA modification in the nucleus and cytosol / negative regulation of phagocytosis / erythrocyte homeostasis / Formation of the ternary complex, and subsequently, the 43S complex / cytoplasmic side of rough endoplasmic reticulum membrane / negative regulation of ubiquitin protein ligase activity / protein kinase A binding / laminin receptor activity / homeostatic process / lncRNA binding / ion channel inhibitor activity / Uptake and function of diphtheria toxin / Ribosomal scanning and start codon recognition / pigmentation / Translation initiation complex formation / positive regulation of mitochondrial depolarization / macrophage chemotaxis / lung morphogenesis / cellular response to actinomycin D / positive regulation of T cell receptor signaling pathway / fibroblast growth factor binding / negative regulation of Wnt signaling pathway / positive regulation of natural killer cell proliferation / male meiosis I / monocyte chemotaxis / TOR signaling / negative regulation of translational frameshifting / BH3 domain binding / positive regulation of activated T cell proliferation / Protein hydroxylation / SARS-CoV-1 modulates host translation machinery / regulation of adenylate cyclase-activating G protein-coupled receptor signaling pathway / iron-sulfur cluster binding / cellular response to ethanol / regulation of cell division / mTORC1-mediated signalling / Peptide chain elongation / skeletal muscle cell differentiation / positive regulation of protein binding / Selenocysteine synthesis / positive regulation of GTPase activity / Formation of a pool of free 40S subunits / positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator / translational elongation / endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / Eukaryotic Translation Termination / blastocyst development / negative regulation of ubiquitin-dependent protein catabolic process / protein serine/threonine kinase inhibitor activity / SRP-dependent cotranslational protein targeting to membrane / Response of EIF2AK4 (GCN2) to amino acid deficiency / ubiquitin ligase inhibitor activity Similarity search - Function | |||||||||||||||||||||||||||
| Biological species | Homo sapiens (human) | |||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.84 Å | |||||||||||||||||||||||||||
Authors | Wei, Z. / Yong, X. | |||||||||||||||||||||||||||
| Funding support | 1items
| |||||||||||||||||||||||||||
Citation | Journal: Nat Commun / Year: 2025Title: Visualizing the translation landscape in human cells at high resolution. Authors: Wei Zheng / Yuekang Zhang / Jimin Wang / Shuhui Wang / Pengxin Chai / Elizabeth J Bailey / Chenghao Zhu / Wangbiao Guo / Swapnil C Devarkar / Shenping Wu / Jianfeng Lin / Kai Zhang / Jun Liu ...Authors: Wei Zheng / Yuekang Zhang / Jimin Wang / Shuhui Wang / Pengxin Chai / Elizabeth J Bailey / Chenghao Zhu / Wangbiao Guo / Swapnil C Devarkar / Shenping Wu / Jianfeng Lin / Kai Zhang / Jun Liu / Ivan B Lomakin / Yong Xiong / ![]() Abstract: Comprehensive in situ structures of macromolecules can transform our understanding of biology and advance human health. Here, we map protein synthesis inside human cells in detail by combining ...Comprehensive in situ structures of macromolecules can transform our understanding of biology and advance human health. Here, we map protein synthesis inside human cells in detail by combining automated cryo-focused ion beam (FIB) milling and in situ single-particle cryo electron microscopy (cryo-EM). With this in situ cryo-EM approach, we resolved a 2.2 Å consensus structure of the human 80S ribosome and unveiled 23 functional states, nearly all better than 3 Å resolution. Compared to in vitro studies, we observed variations in ribosome structures, distinct environments of ion and polyamine binding, and associated proteins such as EDF1 and NACβ that are typically not enriched with purified ribosomes. We also detected additional peptide-related density features on the ribosome and visualized ribosome-ribosome interactions in helical polysomes. Finally, high-resolution structures from cells treated with homoharringtonine and cycloheximide revealed a distinct translational landscape and a spermidine that interacts with cycloheximide at the E site, one of the numerous polyamines that also bind native ribosomes. These results underscore the value of high-resolution in situ studies in the native environment. | |||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 9p9h.cif.gz | 5.5 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb9p9h.ent.gz | Display | PDB format | |
| PDBx/mmJSON format | 9p9h.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/p9/9p9h ftp://data.pdbj.org/pub/pdb/validation_reports/p9/9p9h | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 71411MC ![]() 9p6zC ![]() 9p72C ![]() 9p73C ![]() 9p76C ![]() 9p78C ![]() 9p79C ![]() 9p7aC ![]() 9p7cC ![]() 9p7dC ![]() 9p7eC ![]() 9p7fC ![]() 9p7gC ![]() 9p7hC ![]() 9p7iC ![]() 9p7jC ![]() 9p7kC ![]() 9p7lC ![]() 9p7nC ![]() 9p7oC ![]() 9p7wC ![]() 9p7xC ![]() 9p7yC ![]() 9p8bC ![]() 9p8cC ![]() 9p8hC ![]() 9p8iC ![]() 9p9iC ![]() 9p9jC ![]() 9p9kC ![]() 9pa7C ![]() 9pbeC ![]() 9pkgC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Protein/peptide , 1 types, 1 molecules CI
| #1: Protein/peptide | Mass: 3554.331 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P20290 |
|---|
-RNA chain , 5 types, 5 molecules L5L7L8S2Et
| #2: RNA chain | Mass: 1191482.750 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) |
|---|---|
| #3: RNA chain | Mass: 38691.914 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: GenBank: 23898 |
| #4: RNA chain | Mass: 50157.676 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: CGACUCUUAGCGGUGGAUCACUCGGCUCGUGCGUCGAUGAAGAACGCAGCUAGC(PSU)GCGAGAAUUAAUG(PSU)GAA UU(OMG)CAGGACACAUUGAUCAUCGACACUUCGAACGCACUUGCGGCCCCGGGUUCCUCCCGGGGCUACGCCUGUCUGA GCGUCGCU Source: (natural) Homo sapiens (human) / References: GenBank: 2795773355 |
| #82: RNA chain | Mass: 562093.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) |
| #84: RNA chain | Mass: 24298.369 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) |
+60S ribosomal protein ... , 33 types, 33 molecules LALCLFLGLHLJLMLNLOLPLQLRLSLTLVLXLYLZLaLcLdLeLfLgLhLiLjLkLlLn...
-Large ribosomal subunit protein ... , 7 types, 7 molecules LBLDLELLLbLmLt
| #6: Protein | Mass: 46079.918 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P39023 |
|---|---|
| #8: Protein | Mass: 34008.324 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46777 |
| #9: Protein | Mass: 28694.230 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q02878 |
| #15: Protein | Mass: 24190.484 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P26373 |
| #31: Protein | Mass: 13965.825 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P47914 |
| #42: Protein | Mass: 6199.574 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62987 |
| #48: Protein | Mass: 16972.596 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P30050 |
-Ribosomal protein ... , 2 types, 2 molecules LILW
| #13: Protein | Mass: 24439.754 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q96L21 |
|---|---|
| #26: Protein | Mass: 14476.975 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: A0A994J4A5 |
-Protein , 6 types, 6 molecules LULsSfSgCBCE
| #24: Protein | Mass: 11722.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q7Z4W8 |
|---|---|
| #47: Protein | Mass: 21507.035 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P05388 |
| #62: Protein | Mass: 7884.286 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62979 |
| #63: Protein | Mass: 34669.113 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63244 |
| #83: Protein | Mass: 95232.875 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human)References: UniProt: P13639, Hydrolases; Acting on acid anhydrides; Acting on GTP to facilitate cellular and subcellular movement |
| #85: Protein | Mass: 8777.895 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: Q96CT7 |
-Small ribosomal subunit protein ... , 12 types, 12 molecules SDSMSPSQSRSZSESHSOSVSbSe
| #49: Protein | Mass: 25172.561 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P23396 |
|---|---|
| #52: Protein | Mass: 13652.019 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P25398 |
| #53: Protein | Mass: 14092.600 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62841 |
| #54: Protein | Mass: 16249.062 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62249 |
| #55: Protein | Mass: 15578.156 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P08708 |
| #59: Protein | Mass: 8526.119 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62851 |
| #67: Protein | Mass: 29523.674 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62701 |
| #69: Protein | Mass: 21603.229 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62081 |
| #74: Protein | Mass: 15014.187 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62263 |
| #75: Protein | Mass: 9124.389 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P63220 |
| #80: Protein | Mass: 9348.990 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P42677 |
| #81: Protein | Mass: 6539.758 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62861 |
-40S ribosomal protein ... , 19 types, 19 molecules SFSKSSSTSUScSdSASBSCSGSISJSLSNSWSXSYSa
| #50: Protein | Mass: 21327.723 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46782 |
|---|---|
| #51: Protein | Mass: 11773.953 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46783 |
| #56: Protein | Mass: 17029.844 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62269 |
| #57: Protein | Mass: 15822.219 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P39019 |
| #58: Protein | Mass: 11765.890 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P60866 |
| #60: Protein | Mass: 7263.394 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62857 |
| #61: Protein | Mass: 6559.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62273 |
| #64: Protein | Mass: 24774.365 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P08865 |
| #65: Protein | Mass: 24888.258 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P61247 |
| #66: Protein | Mass: 24587.029 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P15880 |
| #68: Protein | Mass: 27471.535 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62753 |
| #70: Protein | Mass: 24003.012 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62241 |
| #71: Protein | Mass: 21649.633 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P46781 |
| #72: Protein | Mass: 17785.971 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62280 |
| #73: Protein | Mass: 17128.191 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62277 |
| #76: Protein | Mass: 14734.357 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62244 |
| #77: Protein | Mass: 15626.392 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62266 |
| #78: Protein | Mass: 15203.022 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62847 |
| #79: Protein | Mass: 11742.908 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Homo sapiens (human) / References: UniProt: P62854 |
-Non-polymers , 4 types, 242 molecules 






| #86: Chemical | ChemComp-MG / #87: Chemical | ChemComp-SPM / #88: Chemical | ChemComp-SPD / #89: Chemical | ChemComp-ZN / |
|---|
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: CELL / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: In situ human unrotated hibernating with CCDC124 state 80S ribosome Type: RIBOSOME / Entity ID: #1-#85 / Source: NATURAL |
|---|---|
| Source (natural) | Organism: Homo sapiens (human) |
| Buffer solution | pH: 7.4 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Tecnai F30 / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TECNAI F30 |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 1200 nm |
| Image recording | Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) |
-
Processing
| EM software |
| ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: NONE | ||||||||||||||||
| 3D reconstruction | Resolution: 2.84 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 86934 / Symmetry type: POINT |
Movie
Controller
About Yorodumi



Homo sapiens (human)
Citation





































































PDBj

























































FIELD EMISSION GUN