+
Open data
-
Basic information
Entry | Database: PDB / ID: 8vws | |||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Title | Nucleosome containing 8oxoG at SHL-6 | |||||||||||||||||||||||||||||||||
![]() |
| |||||||||||||||||||||||||||||||||
![]() | DNA BINDING PROTEIN/DNA / Nucleosome / 8-oxo-guanine DNA Glycosylase I / DNA Repair / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex | |||||||||||||||||||||||||||||||||
Function / homology | ![]() negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Recognition and association of DNA glycosylase with site containing an affected pyrimidine / Cleavage of the damaged pyrimidine ...negative regulation of megakaryocyte differentiation / protein localization to CENP-A containing chromatin / Chromatin modifying enzymes / Replacement of protamines by nucleosomes in the male pronucleus / CENP-A containing nucleosome / Packaging Of Telomere Ends / Recognition and association of DNA glycosylase with site containing an affected purine / Cleavage of the damaged purine / Recognition and association of DNA glycosylase with site containing an affected pyrimidine / Cleavage of the damaged pyrimidine / Deposition of new CENPA-containing nucleosomes at the centromere / telomere organization / Interleukin-7 signaling / Inhibition of DNA recombination at telomere / Meiotic synapsis / RNA Polymerase I Promoter Opening / Assembly of the ORC complex at the origin of replication / innate immune response in mucosa / Regulation of endogenous retroelements by the Human Silencing Hub (HUSH) complex / SUMOylation of chromatin organization proteins / DNA methylation / Condensation of Prophase Chromosomes / Chromatin modifications during the maternal to zygotic transition (MZT) / HCMV Late Events / SIRT1 negatively regulates rRNA expression / ERCC6 (CSB) and EHMT2 (G9a) positively regulate rRNA expression / PRC2 methylates histones and DNA / Regulation of endogenous retroelements by KRAB-ZFP proteins / Defective pyroptosis / Regulation of endogenous retroelements by Piwi-interacting RNAs (piRNAs) / HDACs deacetylate histones / Nonhomologous End-Joining (NHEJ) / RNA Polymerase I Promoter Escape / Transcriptional regulation by small RNAs / Formation of the beta-catenin:TCF transactivating complex / RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function / Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 / HDMs demethylate histones / G2/M DNA damage checkpoint / NoRC negatively regulates rRNA expression / DNA Damage/Telomere Stress Induced Senescence / B-WICH complex positively regulates rRNA expression / PKMTs methylate histone lysines / Meiotic recombination / Pre-NOTCH Transcription and Translation / Metalloprotease DUBs / RMTs methylate histone arginines / Activation of anterior HOX genes in hindbrain development during early embryogenesis / Transcriptional regulation of granulopoiesis / antimicrobial humoral immune response mediated by antimicrobial peptide / HCMV Early Events / structural constituent of chromatin / antibacterial humoral response / UCH proteinases / nucleosome / heterochromatin formation / E3 ubiquitin ligases ubiquitinate target proteins / nucleosome assembly / Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks / HATs acetylate histones / RUNX1 regulates transcription of genes involved in differentiation of HSCs / chromatin organization / Factors involved in megakaryocyte development and platelet production / MLL4 and MLL3 complexes regulate expression of PPARG target genes in adipogenesis and hepatic steatosis / Processing of DNA double-strand break ends / Senescence-Associated Secretory Phenotype (SASP) / Oxidative Stress Induced Senescence / Estrogen-dependent gene expression / chromosome, telomeric region / defense response to Gram-positive bacterium / Ub-specific processing proteases / Amyloid fiber formation / protein heterodimerization activity / enzyme binding / protein-containing complex / DNA binding / extracellular space / RNA binding / extracellular exosome / extracellular region / nucleoplasm / identical protein binding / nucleus / membrane / cytosol Similarity search - Function | |||||||||||||||||||||||||||||||||
Biological species | ![]() synthetic construct (others) | |||||||||||||||||||||||||||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.1 Å | |||||||||||||||||||||||||||||||||
![]() | Weaver, T.M. / Ling, J.A. / Freudenthal, B.D. | |||||||||||||||||||||||||||||||||
Funding support | ![]()
| |||||||||||||||||||||||||||||||||
![]() | ![]() Title: Contributing factors to the oxidation-induced mutational landscape in human cells. Authors: Cameron Cordero / Kavi P M Mehta / Tyler M Weaver / Justin A Ling / Bret D Freudenthal / David Cortez / Steven A Roberts / ![]() Abstract: 8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently ...8-oxoguanine (8-oxoG) is a common oxidative DNA lesion that causes G > T substitutions. Determinants of local and regional differences in 8-oxoG-induced mutability across genomes are currently unknown. Here, we show DNA oxidation induces G > T substitutions and insertion/deletion (INDEL) mutations in human cells and cancers. Potassium bromate (KBrO)-induced 8-oxoGs occur with similar sequence preferences as their derived substitutions, indicating that the reactivity of specific oxidants dictates mutation sequence specificity. While 8-oxoG occurs uniformly across chromatin, 8-oxoG-induced mutations are elevated in compact genomic regions, within nucleosomes, and at inward facing guanines within strongly positioned nucleosomes. Cryo-electron microscopy structures of OGG1-nucleosome complexes indicate that these effects originate from OGG1's ability to flip outward positioned 8-oxoG lesions into the catalytic pocket while inward facing lesions are occluded by the histone octamer. Mutation spectra from human cells with DNA repair deficiencies reveals contributions of a DNA repair network limiting 8-oxoG mutagenesis, where OGG1- and MUTYH-mediated base excision repair is supplemented by the replication-associated factors Pol η and HMCES. Transcriptional asymmetry of KBrO-induced mutations in OGG1- and Pol η-deficient cells also demonstrates transcription-coupled repair can prevent 8-oxoG-induced mutation. Thus, oxidant chemistry, chromatin structures, and DNA repair processes combine to dictate the oxidative mutational landscape in human genomes. | |||||||||||||||||||||||||||||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 325.6 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 243.5 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.5 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.5 MB | Display | |
Data in XML | ![]() | 44.3 KB | Display | |
Data in CIF | ![]() | 64.7 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 43595MC ![]() 8vwtC ![]() 8vwuC ![]() 8vwvC M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Protein , 4 types, 8 molecules AEBFCGDH
#1: Protein | Mass: 15257.838 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: H3C15, HIST2H3A, H3C14, H3F2, H3FM, HIST2H3C, H3C13, HIST2H3D Production host: ![]() ![]() #2: Protein | Mass: 11263.231 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: H4C1, H4/A, H4FA, HIST1H4A, H4C2, H4/I, H4FI, HIST1H4B, H4C3, H4/G, H4FG, HIST1H4C, H4C4, H4/B, H4FB, HIST1H4D, H4C5, H4/J, H4FJ, HIST1H4E, H4C6, H4/C, H4FC, HIST1H4F, H4C8, H4/H, H4FH, ...Gene: H4C1, H4/A, H4FA, HIST1H4A, H4C2, H4/I, H4FI, HIST1H4B, H4C3, H4/G, H4FG, HIST1H4C, H4C4, H4/B, H4FB, HIST1H4D, H4C5, H4/J, H4FJ, HIST1H4E, H4C6, H4/C, H4FC, HIST1H4F, H4C8, H4/H, H4FH, HIST1H4H, H4C9, H4/M, H4FM, HIST1H4I, H4C11, H4/E, H4FE, HIST1H4J, H4C12, H4/D, H4FD, HIST1H4K, H4C13, H4/K, H4FK, HIST1H4L, H4C14, H4/N, H4F2, H4FN, HIST2H4, HIST2H4A, H4C15, H4/O, H4FO, HIST2H4B, H4-16, HIST4H4 Production host: ![]() ![]() #3: Protein | Mass: 13990.342 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: H2AC11, H2AFP, HIST1H2AG, H2AC13, H2AFC, HIST1H2AI, H2AC15, H2AFD, HIST1H2AK, H2AC16, H2AFI, HIST1H2AL, H2AC17, H2AFN, HIST1H2AM Production host: ![]() ![]() #4: Protein | Mass: 13806.018 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() Gene: H2BC4, H2BFL, HIST1H2BC, H2BC6, H2BFH, HIST1H2BE, H2BC7, H2BFG, HIST1H2BF, H2BC8, H2BFA, HIST1H2BG, H2BC10, H2BFK, HIST1H2BI Production host: ![]() ![]() |
---|
-DNA chain , 2 types, 2 molecules IJ
#5: DNA chain | Mass: 45114.742 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: ATCGAGAATCCCGGT GCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACT CCC TAGTCT CCAGGCACGTGTCAGATCTATACATCCGAT Source: (synth.) synthetic construct (others) |
---|---|
#6: DNA chain | Mass: 45651.059 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) |
-Details
Has ligand of interest | Y |
---|---|
Has protein modification | N |
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component | Name: Nucleosome containing 8oxoG at SHL-6 / Type: COMPLEX / Entity ID: all / Source: RECOMBINANT | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source (natural) | Organism: ![]() | |||||||||||||||||||||||||
Source (recombinant) | Organism: ![]() ![]() | |||||||||||||||||||||||||
Buffer solution | pH: 7.1 Details: 50 mM HEPES (pH-7.1), 100 mM NaCl, 1 mM TCEP, and 1 mM EDTA | |||||||||||||||||||||||||
Buffer component |
| |||||||||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | |||||||||||||||||||||||||
Vitrification | Cryogen name: ETHANE / Humidity: 95 % / Chamber temperature: 277.15 K |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: ![]() |
Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm |
Image recording | Electron dose: 60 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) |
-
Processing
EM software |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
3D reconstruction | Resolution: 3.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 44646 / Symmetry type: POINT | ||||||||||||||||||||||||
Refine LS restraints |
|