[English] 日本語
Yorodumi- PDB-8rq2: Escherichia coli 50S subunit in complex with the antimicrobial pe... -
+Open data
-Basic information
Entry | Database: PDB / ID: 8rq2 | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Title | Escherichia coli 50S subunit in complex with the antimicrobial peptide Api88 - conformation III | ||||||||||||||||||
Components |
| ||||||||||||||||||
Keywords | RIBOSOME / antimicrobial peptide / RNA / ribosomal protein / PrAMP / proline-rich peptide / antibiotics / 50S / Api88 | ||||||||||||||||||
Function / homology | Function and homology information negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / translational initiation ...negative regulation of cytoplasmic translational initiation / transcriptional attenuation / endoribonuclease inhibitor activity / RNA-binding transcription regulator activity / positive regulation of ribosome biogenesis / negative regulation of cytoplasmic translation / DnaA-L2 complex / translation repressor activity / negative regulation of DNA-templated DNA replication initiation / translational initiation / ribosome assembly / mRNA regulatory element binding translation repressor activity / assembly of large subunit precursor of preribosome / cytosolic ribosome assembly / response to reactive oxygen species / regulation of cell growth / DNA-templated transcription termination / response to radiation / ribosomal large subunit assembly / mRNA 5'-UTR binding / large ribosomal subunit / ribosome binding / transferase activity / 5S rRNA binding / large ribosomal subunit rRNA binding / cytosolic large ribosomal subunit / tRNA binding / cytoplasmic translation / rRNA binding / negative regulation of translation / ribosome / structural constituent of ribosome / translation / response to antibiotic / negative regulation of DNA-templated transcription / mRNA binding / DNA binding / RNA binding / zinc ion binding / cytoplasm / cytosol Similarity search - Function | ||||||||||||||||||
Biological species | Escherichia coli (E. coli) Apis mellifera (honey bee) | ||||||||||||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.44 Å | ||||||||||||||||||
Authors | Lauer, S. / Nikolay, R. / Spahn, C. | ||||||||||||||||||
Funding support | Germany, 5items
| ||||||||||||||||||
Citation | Journal: Nat Commun / Year: 2024 Title: Multimodal binding and inhibition of bacterial ribosomes by the antimicrobial peptides Api137 and Api88. Authors: Simon M Lauer / Maren Reepmeyer / Ole Berendes / Dorota Klepacki / Jakob Gasse / Sara Gabrielli / Helmut Grubmüller / Lars V Bock / Andor Krizsan / Rainer Nikolay / Christian M T Spahn / Ralf Hoffmann / Abstract: Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized ...Proline-rich antimicrobial peptides (PrAMPs) inhibit bacterial protein biosynthesis by binding to the polypeptide exit tunnel (PET) near the peptidyl transferase center. Api137, an optimized derivative of honeybee PrAMP apidaecin, inhibits protein expression by trapping release factors (RFs), which interact with stop codons on ribosomes to terminate translation. This study uses cryo-EM, functional assays and molecular dynamic (MD) simulations to show that Api137 additionally occupies a second binding site near the exit of the PET and can repress translation independently of RF-trapping. Api88, a C-terminally amidated (-CONH) analog of Api137 (-COOH), binds to the same sites, occupies a third binding pocket and interferes with the translation process presumably without RF-trapping. In conclusion, apidaecin-derived PrAMPs inhibit bacterial ribosomes by multimodal mechanisms caused by minor structural changes and thus represent a promising pool for drug development efforts. | ||||||||||||||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 8rq2.cif.gz | 2.2 MB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb8rq2.ent.gz | 1.7 MB | Display | PDB format |
PDBx/mmJSON format | 8rq2.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Summary document | 8rq2_validation.pdf.gz | 1.6 MB | Display | wwPDB validaton report |
---|---|---|---|---|
Full document | 8rq2_full_validation.pdf.gz | 1.6 MB | Display | |
Data in XML | 8rq2_validation.xml.gz | 125.1 KB | Display | |
Data in CIF | 8rq2_validation.cif.gz | 225.3 KB | Display | |
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/rq/8rq2 ftp://data.pdbj.org/pub/pdb/validation_reports/rq/8rq2 | HTTPS FTP |
-Related structure data
Related structure data | 19429MC 8rpyC 8rpzC 8rq0C M: map data used to model this data C: citing same article (ref.) |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
+Large ribosomal subunit protein ... , 29 types, 29 molecules 012346CDEFGHJKLMNOPQRSTUVWXYZ
-RNA chain , 2 types, 2 molecules AB
#7: RNA chain | Mass: 941321.250 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Escherichia coli (E. coli) |
---|---|
#8: RNA chain | Mass: 38813.133 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGU GUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAA Source: (natural) Escherichia coli (E. coli) |
-Protein/peptide , 1 types, 3 molecules xyz
#32: Protein/peptide | Mass: 2082.460 Da / Num. of mol.: 3 / Source method: obtained synthetically / Source: (synth.) Apis mellifera (honey bee) |
---|
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-Sample preparation
Component |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Experimental value: NO | ||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||
Source (recombinant) | Organism: synthetic construct (others) | ||||||||||||||||||||||||
Buffer solution | pH: 7.6 | ||||||||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
Specimen support | Grid material: COPPER / Grid mesh size: 400 divisions/in. / Grid type: Quantifoil R2/2 | ||||||||||||||||||||||||
Vitrification | Cryogen name: ETHANE |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: TFS KRIOS |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: OTHER |
Electron lens | Mode: OTHER / Nominal defocus max: 2000 nm / Nominal defocus min: 500 nm |
Image recording | Electron dose: 26 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) |
-Processing
EM software |
| ||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||||||
3D reconstruction | Resolution: 2.44 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 260475 / Symmetry type: POINT | ||||||||||||||||||||||||||||||||
Atomic model building | Space: REAL | ||||||||||||||||||||||||||||||||
Refine LS restraints |
|