+Open data
-Basic information
Entry | Database: PDB / ID: 8rcf | ||||||
---|---|---|---|---|---|---|---|
Title | RAD51 nucleoprotein filament on double-stranded abasic DNA | ||||||
Components |
| ||||||
Keywords | DNA BINDING PROTEIN / Homologous recombination / DNA replication / abasic DNA | ||||||
Function / homology | Function and homology information presynaptic intermediate filament cytoskeleton / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to camptothecin / telomere maintenance via telomere lengthening / positive regulation of DNA ligation / nuclear ubiquitin ligase complex / double-strand break repair involved in meiotic recombination / cellular response to hydroxyurea / DNA recombinase assembly ...presynaptic intermediate filament cytoskeleton / mitotic recombination-dependent replication fork processing / chromosome organization involved in meiotic cell cycle / cellular response to camptothecin / telomere maintenance via telomere lengthening / positive regulation of DNA ligation / nuclear ubiquitin ligase complex / double-strand break repair involved in meiotic recombination / cellular response to hydroxyurea / DNA recombinase assembly / lateral element / replication-born double-strand break repair via sister chromatid exchange / telomere maintenance via recombination / DNA strand invasion / regulation of DNA damage checkpoint / mitotic recombination / Impaired BRCA2 binding to PALB2 / DNA strand exchange activity / single-stranded DNA helicase activity / reciprocal meiotic recombination / Defective homologous recombination repair (HRR) due to BRCA1 loss of function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA1 binding function / Defective HDR through Homologous Recombination Repair (HRR) due to PALB2 loss of BRCA2/RAD51/RAD51C binding function / Homologous DNA Pairing and Strand Exchange / Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA) / Resolution of D-loop Structures through Holliday Junction Intermediates / ATP-dependent DNA damage sensor activity / HDR through Single Strand Annealing (SSA) / Impaired BRCA2 binding to RAD51 / regulation of double-strand break repair via homologous recombination / nuclear chromosome / DNA unwinding involved in DNA replication / replication fork processing / Transcriptional Regulation by E2F6 / Presynaptic phase of homologous DNA pairing and strand exchange / ATP-dependent activity, acting on DNA / interstrand cross-link repair / DNA polymerase binding / condensed chromosome / condensed nuclear chromosome / male germ cell nucleus / meiotic cell cycle / cellular response to ionizing radiation / regulation of protein phosphorylation / double-strand break repair via homologous recombination / HDR through Homologous Recombination (HRR) / PML body / Meiotic recombination / site of double-strand break / single-stranded DNA binding / double-stranded DNA binding / DNA recombination / chromosome, telomeric region / mitochondrial matrix / DNA repair / centrosome / DNA damage response / chromatin binding / chromatin / nucleolus / perinuclear region of cytoplasm / enzyme binding / ATP hydrolysis activity / protein-containing complex / mitochondrion / nucleoplasm / ATP binding / identical protein binding / nucleus / cytosol / cytoplasm Similarity search - Function | ||||||
Biological species | Homo sapiens (human) | ||||||
Method | ELECTRON MICROSCOPY / helical reconstruction / cryo EM / Resolution: 3.4 Å | ||||||
Authors | Appleby, R. / Pellegrini, L. | ||||||
Funding support | United Kingdom, 1items
| ||||||
Citation | Journal: Mol Cell / Year: 2024 Title: RAD51 protects abasic sites to prevent replication fork breakage. Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele ...Authors: Yodhara Wijesekara Hanthi / Miguel Angel Ramirez-Otero / Robert Appleby / Anna De Antoni / Luay Joudeh / Vincenzo Sannino / Salli Waked / Alessandra Ardizzoia / Viviana Barra / Daniele Fachinetti / Luca Pellegrini / Vincenzo Costanzo / Abstract: Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture ...Abasic sites are DNA lesions repaired by base excision repair. Cleavage of unrepaired abasic sites in single-stranded DNA (ssDNA) can lead to chromosomal breakage during DNA replication. How rupture of abasic DNA is prevented remains poorly understood. Here, using cryoelectron microscopy (cryo-EM), Xenopus laevis egg extracts, and human cells, we show that RAD51 nucleofilaments specifically recognize and protect abasic sites, which increase RAD51 association rate to DNA. In the absence of BRCA2 or RAD51, abasic sites accumulate as a result of DNA base methylation, oxidation, and deamination, inducing abasic ssDNA gaps that make replicating DNA fibers sensitive to APE1. RAD51 assembled on abasic DNA prevents abasic site cleavage by the MRE11-RAD50 complex, suppressing replication fork breakage triggered by an excess of abasic sites or POLθ polymerase inhibition. Our study highlights the critical role of BRCA2 and RAD51 in safeguarding against unrepaired abasic sites in DNA templates stemming from base alterations, ensuring genomic stability. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 8rcf.cif.gz | 445.9 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb8rcf.ent.gz | 368.2 KB | Display | PDB format |
PDBx/mmJSON format | 8rcf.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Summary document | 8rcf_validation.pdf.gz | 1.7 MB | Display | wwPDB validaton report |
---|---|---|---|---|
Full document | 8rcf_full_validation.pdf.gz | 1.7 MB | Display | |
Data in XML | 8rcf_validation.xml.gz | 75.2 KB | Display | |
Data in CIF | 8rcf_validation.cif.gz | 102.6 KB | Display | |
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/rc/8rcf ftp://data.pdbj.org/pub/pdb/validation_reports/rc/8rcf | HTTPS FTP |
-Related structure data
Related structure data | 19051MC 8rcdC C: citing same article (ref.) M: map data used to model this data |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
#1: Protein | Mass: 37009.125 Da / Num. of mol.: 8 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD51, RAD51A, RECA / Production host: Escherichia coli (E. coli) / References: UniProt: Q06609 #2: DNA chain | | Mass: 6282.902 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. ...Details: 3DR refers to an abasic nucleotide. The ribose of the abasic nucleotide is a tetrahydrofurane lacking the hydroxyl group that would naturally be present on position C1 after base hydrolysis. The sequence consists of 7 x TG(3DR) + TG, as helically averaged version of the DNA sequence: GGTAT(3DR)CA(3DR)TG(3DR)TA(3DR)AC(3DR)TGAGC, which contains 5 central, equally spaced abasic sites flanked by 5 nucleotides. Source: (synth.) Homo sapiens (human) #3: DNA chain | | Mass: 6798.423 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: The sequence consists of 7 x CAC + CA, as helically averaged version of the DNA sequence: GCTCACGTCTACCACTGCATACC Source: (synth.) Homo sapiens (human) #4: Chemical | ChemComp-CA / #5: Chemical | ChemComp-ATP / Has ligand of interest | Y | |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: FILAMENT / 3D reconstruction method: helical reconstruction |
-Sample preparation
Component |
| ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Molecular weight | Experimental value: NO | ||||||||||||||||||||||||
Source (natural) |
| ||||||||||||||||||||||||
Source (recombinant) |
| ||||||||||||||||||||||||
Buffer solution | pH: 7.5 | ||||||||||||||||||||||||
Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES | ||||||||||||||||||||||||
Specimen support | Grid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3 | ||||||||||||||||||||||||
Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
Electron lens | Mode: BRIGHT FIELD / Calibrated magnification: 130000 X / Nominal defocus max: 2600 nm / Nominal defocus min: 800 nm |
Specimen holder | Cryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER |
Image recording | Average exposure time: 1.2 sec. / Electron dose: 52.968 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of real images: 10084 Details: Images were collected in movie mode at 44 frames per movie |
-Processing
EM software |
| ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||||||
Helical symmerty | Angular rotation/subunit: 56 ° / Axial rise/subunit: 15.8 Å / Axial symmetry: C1 | ||||||||||||||||||||||||||||
Particle selection | Num. of particles selected: 1791680 | ||||||||||||||||||||||||||||
3D reconstruction | Resolution: 3.4 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 8853 / Symmetry type: HELICAL | ||||||||||||||||||||||||||||
Atomic model building | Protocol: OTHER / Space: REAL | ||||||||||||||||||||||||||||
Atomic model building | PDB-ID: 8BR2 Accession code: 8BR2 / Source name: PDB / Type: experimental model | ||||||||||||||||||||||||||||
Refine LS restraints |
|