[English] 日本語
Yorodumi
- PDB-8dk2: CryoEM structure of Pseudomonas aeruginosa PA14 JetABC in an uncl... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8dk2
TitleCryoEM structure of Pseudomonas aeruginosa PA14 JetABC in an unclamped state trapped in ATP dependent dimeric form
Components
  • (DNA (26-MER)) x 2
  • JetA
  • JetB
  • JetC
KeywordsDNA BINDING PROTEIN/DNA / Wadjet / Bacterial defense systems / JetA / JetB / JetC / Anti-plasmid defense system / EptA / EptB / EptC / MksB / MksE / MksF / SMC / DNA BINDING PROTEIN-DNA complex
Function / homology
Function and homology information


Wadjet protein JetB / Wadjet protein JetB / Protein of unknown function DUF3375 / Protein of unknown function (DUF3375) / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER / DNA / DNA (> 10) / DUF3375 domain-containing protein / DUF4194 domain-containing protein / ATP synthase
Similarity search - Component
Biological speciesPseudomonas aeruginosa PA14 (bacteria)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.1 Å
AuthorsDeep, A. / Gu, Y. / Gao, Y. / Ego, K. / Herzik, M. / Zhou, H. / Corbett, K.
Funding support United States, 2items
OrganizationGrant numberCountry
National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)R01 GM104141 United States
National Institutes of Health/National Institute Of Allergy and Infectious Diseases (NIH/NIAID)R21 AI148814 United States
CitationJournal: Mol Cell / Year: 2022
Title: The SMC-family Wadjet complex protects bacteria from plasmid transformation by recognition and cleavage of closed-circular DNA.
Authors: Amar Deep / Yajie Gu / Yong-Qi Gao / Kaori M Ego / Mark A Herzik / Huilin Zhou / Kevin D Corbett /
Abstract: Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through ...Self versus non-self discrimination is a key element of innate and adaptive immunity across life. In bacteria, CRISPR-Cas and restriction-modification systems recognize non-self nucleic acids through their sequence and their methylation state, respectively. Here, we show that the Wadjet defense system recognizes DNA topology to protect its host against plasmid transformation. By combining cryoelectron microscopy with cross-linking mass spectrometry, we show that Wadjet forms a complex similar to the bacterial condensin complex MukBEF, with a novel nuclease subunit similar to a type II DNA topoisomerase. Wadjet specifically cleaves closed-circular DNA in a reaction requiring ATP hydrolysis by the structural maintenance of chromosome (SMC) ATPase subunit JetC, suggesting that the complex could use DNA loop extrusion to sense its substrate's topology, then specifically activate the nuclease subunit JetD to cleave plasmid DNA. Overall, our data reveal how bacteria have co-opted a DNA maintenance machine to specifically recognize and destroy foreign DNAs through topology sensing.
History
DepositionJul 1, 2022Deposition site: RCSB / Processing site: RCSB
Revision 1.0Oct 5, 2022Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 2 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 3 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 2 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 3 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 2 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 3 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 2 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Additional map / Part number: 3 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Oct 5, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Nov 2, 2022Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _citation_author.name
Revision 1.2Nov 16, 2022Group: Database references / Category: citation / Item: _citation.journal_volume / _citation.page_first
Revision 1.3Jun 12, 2024Group: Data collection / Category: chem_comp_atom / chem_comp_bond
Revision 1.4May 14, 2025Group: Data collection / Structure summary / Category: em_admin / em_software / pdbx_entry_details
Item: _em_admin.last_update / _em_software.name / _pdbx_entry_details.has_protein_modification
Revision 1.1May 14, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Data processing / Experimental summary / Data content type: EM metadata / EM metadata / Category: em_admin / em_software / Data content type: EM metadata / EM metadata / Item: _em_admin.last_update / _em_software.name

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: JetA
B: JetA
C: JetC
D: JetC
F: JetB
G: JetB
H: JetB
I: JetB
P: DNA (26-MER)
Q: DNA (26-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)499,03914
Polymers497,94410
Non-polymers1,0954
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: light scattering, The complex can also form a dimeric assembly with the following stoichiometry: 2 JetA, 4 JetB, 4 JetC.
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Protein , 3 types, 8 molecules ABCDFGHI

#1: Protein JetA


Mass: 59233.500 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: PA14_03250 / Production host: Escherichia coli (E. coli) / References: UniProt: A0A0H2ZJP9
#2: Protein JetC


Mass: 126683.180 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: IPC1494_27645, IPC1595_14260, IPC607_32065 / Production host: Escherichia coli (E. coli) / References: UniProt: A0A8G4Z850
#3: Protein
JetB


Mass: 27537.037 Da / Num. of mol.: 4
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Pseudomonas aeruginosa PA14 (bacteria) / Gene: PA14_03265 / Production host: Escherichia coli (E. coli) / References: UniProt: A0A0H2ZL66

-
DNA chain , 2 types, 2 molecules PQ

#4: DNA chain DNA (26-MER)


Mass: 7864.056 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC
Source: (synth.) synthetic construct (others)
#5: DNA chain DNA (26-MER)


Mass: 8098.421 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to ...Details: Below mentioned hybridized oligonucleotides were used in the sample preparation. Considering the DNA binding is purely based on the electrostatic charge: polyA/polyT chain was used to generate the model. JetABC_cryo_Fwd: GTGATAGTTAGAAACGTAATTGACTATAAAGATGATGACGATAAGTAGGATGTCTATAGACCAGG JetABC_cryo_Rev: CCTGGTCTATAGACATCCTACTTATCGTCATCATCTTTATAGTCAATTACGTTTCTAACTATCAC
Source: (synth.) synthetic construct (others)

-
Non-polymers , 2 types, 4 molecules

#6: Chemical ChemComp-AGS / PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER / ATP-GAMMA-S / ADENOSINE 5'-(3-THIOTRIPHOSPHATE) / ADENOSINE 5'-(GAMMA-THIOTRIPHOSPHATE) / ADENOSINE-5'-DIPHOSPHATE MONOTHIOPHOSPHATE


Mass: 523.247 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: C10H16N5O12P3S / Feature type: SUBJECT OF INVESTIGATION / Comment: ATP-gamma-S, energy-carrying molecule analogue*YM
#7: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Mg / Feature type: SUBJECT OF INVESTIGATION

-
Details

Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Reconstituted JetABC complex in the presence of DNA and ATP gamma S.
Type: COMPLEX / Entity ID: #1-#5 / Source: MULTIPLE SOURCES
Molecular weightValue: 0.481 MDa / Experimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
21Pseudomonas aeruginosa PA14 (bacteria)652611
31synthetic construct (others)32630
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 7.5
Details: Prepared using deionized water and filtered sterilized.
Buffer component
IDConc.NameFormulaBuffer-ID
160 mMSodium ChlorideNaCl1
230 mMtris(hydroxymethyl)aminomethaneC4H11NO31
31 mMTCEPC9H16ClO6P1
41 mMATP gamma SC10H16N5O12P3S1
52 mMMagnesium ChlorideMgCl21
SpecimenConc.: 1.5 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 277 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 500 nm
Image recordingElectron dose: 50.1 e/Å2 / Detector mode: COUNTING / Film or detector model: GATAN K2 QUANTUM (4k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.20.1_4487: / Classification: refinement
EM software
IDNameVersionCategory
4cryoSPARC3.3.1CTF correction
9PHENIXmodel refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 4.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 56600 / Symmetry type: POINT
Atomic model buildingProtocol: AB INITIO MODEL / Space: REAL
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00224198
ELECTRON MICROSCOPYf_angle_d0.45332924
ELECTRON MICROSCOPYf_dihedral_angle_d13.5459253
ELECTRON MICROSCOPYf_chiral_restr0.0353718
ELECTRON MICROSCOPYf_plane_restr0.0044130

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more