[English] 日本語
Yorodumi
- PDB-9rjs: Structure of the Bacteriophage PhiKZ non-virion RNA Polymerase bo... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9rjs
TitleStructure of the Bacteriophage PhiKZ non-virion RNA Polymerase bound to an analogue of its promoter
Components
  • DNA - ATGAGTAATTTTAGTGAATGTATTTGCTATATTGCTATGTAGACAGTTCCCAAAAGCCTAAAGTTACAATATAGG
  • DNA - CCTATATTGTAACTTTAGGCTTTTGGGAACTCCTCTCATATTCCCATAGCAAATACATTCACTAAAATTACTCAT
  • DNA-directed RNA polymerase,PHIKZ056.1
  • PHIKZ068
  • PHIKZ071
  • PHIKZ074
  • PHIKZ123
KeywordsRNA BINDING PROTEIN / PhiKZ / nvRNAP / RNA / DNA / transcription
Function / homologymetal ion binding / DNA / DNA (> 10) / DNA-directed RNA polymerase / PHIKZ056.1 / PHIKZ123 / PHIKZ074 / PHIKZ068
Function and homology information
Biological speciesPhikzvirus phiKZ
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.59 Å
AuthorsChen, C. / de Martin Garrido, N. / Yakunina, M. / Aylett, C.H.S.
Funding support United Kingdom, 2items
OrganizationGrant numberCountry
Wellcome Trust206212/Z/17/A United Kingdom
Royal Society206212/Z/17/A United Kingdom
CitationJournal: IUCrJ / Year: 2026
Title: Structure of the bacteriophage PhiKZ non-virion RNA polymerase bound to a p119L open promoter analogue.
Authors: Chao Sheng Chen / Natàlia de Martín Garrido / Maria Yakunina / Christopher H S Aylett /
Abstract: Bacteriophage ΦKZ (PhiKZ) was the first identified member of a family of massive bacterial viruses. ΦKZ infects Pseudomonas aeruginosa, which kills tens of thousands every year, and it therefore ...Bacteriophage ΦKZ (PhiKZ) was the first identified member of a family of massive bacterial viruses. ΦKZ infects Pseudomonas aeruginosa, which kills tens of thousands every year, and it therefore has potential as a bacteriophage therapy. On infection, ΦKZ forms a `nucleus' to protect its genome by excluding host immune systems. This barrier means that it has had to become independent of the host transcriptional apparatus; it cannot simply recruit the host RNA polymerase (RNAP) to its promoters as it is excluded from the viral DNA, and therefore it expresses and imports its own non-virion RNA polymerase (nvRNAP). The ΦKZ nvRNAP, and related jumbo-phage RNAPs including that from bacteriophage AR9, are particularly noteworthy. Unlike typical viral RNAPs which are formed as only a single subunit, it is a non-canonical multi-subunit RNAP directly related to those from eubacteria, and more distantly eukaryotes and archaea. It encompasses four proteins representing patchwork homologues of the eubacterial β/β' subunits, and a fifth that appears to have evolved from a σ factor, but no homologues of the α or ω subunits required for formation of a catalytically active complex in eubacterial RNAPs. Its mechanism of promoter recognition is also highly divergent; transcription is initiated from a site marked only by a tiny four-base consensus sequence co-located with the start site. We have resolved the structure of the ΦKZ nvRNAP bound to an open analogue of its cognate promoter, p119L, revealing that while the σ-factor-like subunit GP68 is involved in bubble stabilization, the sequence-specific promoter consensus sequence is bound between the lobe of the β-subunit homologue GP123 and the enzymatic core of the complex. Our results shed light on the differences between mechanisms of promoter recognition in the ΦKZ nvRNAP and canonical eubacterial RNAPs, and on the uniquely specialized features of bacteriophage transcriptional apparatuses in general.
History
DepositionJun 12, 2025Deposition site: PDBE / Processing site: PDBE
Revision 1.0Jul 16, 2025Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Additional map / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Mask / Data content type: Mask / Provider: repository / Type: Initial release
Revision 1.0Jul 16, 2025Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Apr 1, 2026Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.journal_abbrev / _citation.journal_id_ASTM ..._citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 1.1Apr 1, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / EM metadata / Category: citation / citation_author / em_admin
Data content type: EM metadata / EM metadata ...EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata
Item: _citation.journal_abbrev / _citation.journal_id_ASTM ..._citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA-directed RNA polymerase,PHIKZ056.1
B: PHIKZ068
C: PHIKZ071
D: PHIKZ074
E: PHIKZ123
X: DNA - ATGAGTAATTTTAGTGAATGTATTTGCTATATTGCTATGTAGACAGTTCCCAAAAGCCTAAAGTTACAATATAGG
Y: DNA - CCTATATTGTAACTTTAGGCTTTTGGGAACTCCTCTCATATTCCCATAGCAAATACATTCACTAAAATTACTCAT
hetero molecules


Theoretical massNumber of molelcules
Total (without water)382,9049
Polymers382,7737
Non-polymers1312
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
Protein , 5 types, 5 molecules ABCDE

#1: Protein DNA-directed RNA polymerase,PHIKZ056.1


Mass: 57976.605 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Phikzvirus phiKZ / Production host: Escherichia coli (E. coli) / References: UniProt: I7DB47, UniProt: L7T138
#2: Protein PHIKZ068


Mass: 59442.824 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Details: Numbering correct in original mmCIF file / Source: (gene. exp.) Phikzvirus phiKZ / Production host: Escherichia coli (E. coli) / References: UniProt: Q8SD94
#3: Protein PHIKZ071


Mass: 78780.453 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Phikzvirus phiKZ / Production host: Escherichia coli (E. coli)
#4: Protein PHIKZ074


Mass: 77513.461 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Phikzvirus phiKZ / Production host: Escherichia coli (E. coli) / References: UniProt: Q8SD88
#5: Protein PHIKZ123


Mass: 62959.090 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Phikzvirus phiKZ / Production host: Escherichia coli (E. coli) / References: UniProt: Q8SD39

-
DNA chain , 2 types, 2 molecules XY

#6: DNA chain DNA - ATGAGTAATTTTAGTGAATGTATTTGCTATATTGCTATGTAGACAGTTCCCAAAAGCCTAAAGTTACAATATAGG


Mass: 23218.951 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Phikzvirus phiKZ
#7: DNA chain DNA - CCTATATTGTAACTTTAGGCTTTTGGGAACTCCTCTCATATTCCCATAGCAAATACATTCACTAAAATTACTCAT


Mass: 22881.719 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Phikzvirus phiKZ

-
Non-polymers , 1 types, 2 molecules

#8: Chemical ChemComp-ZN / ZINC ION


Mass: 65.409 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Zn

-
Details

Has ligand of interestN
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: PhiKZ non-virion RNA polymerase bound to an analogue of promoter p119L
Type: COMPLEX
Details: Mismatches introduced around the transcription start site to stably open the bubble
Entity ID: #1-#7 / Source: RECOMBINANT
Molecular weightValue: 0.4 MDa / Experimental value: NO
Source (natural)Organism: Pseudomonas phage phiKZ (virus)
Source (recombinant)Organism: Escherichia coli (E. coli) / Strain: BL21(DE3) / Plasmid: pET vectors
Buffer solutionpH: 8
Buffer component
IDConc.NameFormulaBuffer-ID
140 mMTris-ClTris-Cl1
210 mMMgCl2MgCl21
35 mMDTTDTT1
SpecimenConc.: 0.1 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Details: PhiKZ nvRNAP complexes were mixed at 0.1 mg/mL final concentration with the P119L promoter analogue at a 1:1 ratio. Reactions were incubated for 30 min at 25 C before use.
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R2/1
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 289 K
Details: Settings: -4 blot force, 4 s waiting time and 0.5-1 s blotting time.

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 130000 X / Nominal defocus max: 2500 nm / Nominal defocus min: 750 nm / Cs: 2.7 mm / C2 aperture diameter: 50 µm / Alignment procedure: ZEMLIN TABLEAU
Specimen holderCryogen: NITROGEN / Specimen holder model: FEI TITAN KRIOS AUTOGRID HOLDER
Image recordingElectron dose: 50 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k) / Num. of grids imaged: 1 / Num. of real images: 20670 / Details: Images collected as TIFF movies
EM imaging opticsEnergyfilter name: GIF Bioquantum / Energyfilter slit width: 10 eV
Image scansSampling size: 5 µm / Width: 5760 / Height: 4092

-
Processing

EM software
IDNameVersionCategoryDetails (eV)
1EMANparticle selection
2EPUimage acquisition
4CTFFIND4CTF correction
7UCSF Chimeramodel fittingRigid body
9RELION4initial Euler assignment
10RELION4final Euler assignment
11RELION4classification
12RELION43D reconstruction
13PHENIXmodel refinementReal space refine
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 4178816
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 2.59 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 329400 / Algorithm: FOURIER SPACE / Num. of class averages: 1 / Symmetry type: POINT
Atomic model buildingB value: 104.82 / Protocol: AB INITIO MODEL / Space: REAL / Target criteria: CC
Atomic model building

3D fitting-ID: 1

IDPDB-IDChain-IDChain residue rangeSource nameTypeDetails (eV)Accession codeInitial refinement model-ID
1B0-278AlphaFoldin silico model
2XOtherin silico modelIdealised B-DNA
3YOtherin silico modelIdealised B-DNA
47OGPPDBexperimental model7OGP3
57OGRPDBexperimental model7OGR4
RefinementCross valid method: NONE
Stereochemistry target values: GeoStd + Monomer Library + CDL v1.2
Displacement parametersBiso mean: 101.01 Å2
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.002921696
ELECTRON MICROSCOPYf_angle_d0.410229578
ELECTRON MICROSCOPYf_chiral_restr0.0393256
ELECTRON MICROSCOPYf_plane_restr0.00333621
ELECTRON MICROSCOPYf_dihedral_angle_d14.10783222

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more