[English] 日本語
Yorodumi
- PDB-9prc: HDAg complex with 86-pRNA, Body1 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9prc
TitleHDAg complex with 86-pRNA, Body1
Components
  • Palindromic RNA
  • Small delta antigen
KeywordsVIRUS / HDV / HDAg / RNP / RNA
Function / homology
Function and homology information


virion component / viral penetration into host nucleus / host cell / symbiont entry into host cell / host cell nucleus / RNA binding
Similarity search - Function
Hepatitis delta virus delta antigen / Delta antigen, N-terminal / Hepatitis delta virus delta antigen / Hepatitis delta antigen (HDAg) domain / Hepatitis delta antigen (HDAg) domain profile.
Similarity search - Domain/homology
RNA / RNA (> 10) / Small delta antigen
Similarity search - Component
Biological speciesHepatitis delta virus
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.5 Å
AuthorsItskanov, S. / Lansdon, E.B.
Funding support United States, 1items
OrganizationGrant numberCountry
Not funded United States
CitationJournal: Proc Natl Acad Sci U S A / Year: 2026
Title: Structural characterization of the HDV virion and its ribonucleoprotein.
Authors: Samuel Itskanov / Beatrice Ary / Upasana Mehra / Irene Lew / Nikolai Novikov / Uli Schmitz / Meghan M Holdorf / Rudolf K Beran / Eric B Lansdon /
Abstract: Hepatitis D virus (HDV) is a small RNA satellite virus of hepatitis B virus (HBV) which encodes a single protein, HDV delta antigen (HDAg), that is required for replication. Viral replication occurs ...Hepatitis D virus (HDV) is a small RNA satellite virus of hepatitis B virus (HBV) which encodes a single protein, HDV delta antigen (HDAg), that is required for replication. Viral replication occurs independently from HBV and relies primarily on host RNA polymerase(s). Bulevirtide, a viral entry inhibitor, is the only approved treatment for chronic HDV but has a low cure rate as a monotherapy, and most patients rebound following cessation of therapy. It is likely that an inhibitor targeting HDV replication is necessary to achieve HDV cure, but the paucity of HDV-derived elements and limited understanding of HDV replication presents a significant therapeutic challenge. Understanding the precise mechanism of interactions between HDAg and viral RNA, and how it is packaged within the virion can inspire structure-guided drug design targeting replication. Using cryoelectron tomography and single particle cryoelectron microscopy, we present reconstructions of the virion and viral RNPs. We observed multiple binding configurations in vitro that suggest a propensity to arrange four RNA segments around repeating units of HDAg in a ladder-like formation. The oligomerization domains of a homo-octameric HDAg complex are directly involved in RNA binding by utilizing the vertices and sides of its square-shaped architecture to bind RNA in a sequence-promiscuous fashion. Structure-function analysis reveals that these RNA contact sites are important for viral replication and their disruption may be a potential avenue for next-generation antivirals to treat HDV.
History
DepositionJul 23, 2025Deposition site: RCSB / Processing site: RCSB
Revision 1.0Jan 28, 2026Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Jan 28, 2026Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Feb 4, 2026Group: Data collection / Database references / Category: citation / em_admin
Item: _citation.pdbx_database_id_PubMed / _citation.title / _em_admin.last_update
Revision 1.1Feb 4, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / Category: citation / em_admin / Data content type: EM metadata / EM metadata / EM metadata
Item: _citation.pdbx_database_id_PubMed / _citation.title / _em_admin.last_update
Revision 1.2Apr 1, 2026Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.page_first / _citation.page_last ..._citation.page_first / _citation.page_last / _citation_author.identifier_ORCID / _em_admin.last_update
Revision 1.2Apr 1, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / EM metadata / Category: citation / citation_author / em_admin
Data content type: EM metadata / EM metadata ...EM metadata / EM metadata / EM metadata / EM metadata
Item: _citation.page_first / _citation.page_last ..._citation.page_first / _citation.page_last / _citation_author.identifier_ORCID / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Small delta antigen
B: Small delta antigen
C: Small delta antigen
D: Small delta antigen
E: Small delta antigen
F: Small delta antigen
G: Small delta antigen
H: Small delta antigen
J: Palindromic RNA
K: Palindromic RNA
M: Palindromic RNA
P: Palindromic RNA


Theoretical massNumber of molelcules
Total (without water)245,16212
Polymers245,16212
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein
Small delta antigen / S-HDAg / p24


Mass: 21854.631 Da / Num. of mol.: 8
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Hepatitis delta virus / Production host: Escherichia coli (E. coli) / References: UniProt: P0C6L3
#2: RNA chain
Palindromic RNA


Mass: 17581.357 Da / Num. of mol.: 4 / Source method: obtained synthetically
Details: 86-nucleotide palindromic RNA sequence. Residues from the T7 promoter (GGGAGA) and EcoRI restriction site (GAAUU) are added to start and end of sequence, respectively. The portions of RNA ...Details: 86-nucleotide palindromic RNA sequence. Residues from the T7 promoter (GGGAGA) and EcoRI restriction site (GAAUU) are added to start and end of sequence, respectively. The portions of RNA that could be traced in the map were modeled as poly(AU) due to uncertainty of residue identity.
Source: (synth.) synthetic construct (others)
Has protein modificationN
Sequence detailsAt the resolution of the map, the identities of the individual bases could not be determined. ...At the resolution of the map, the identities of the individual bases could not be determined. Therefore, the modeled fragments of RNA were modeled as poly(AU). The actual sequence of the palindromic RNA is GGGAGACCGCGGUCCUUGUUCGGUUGGCUCAUCUCGACUGGGCGACGGUUUCGUCGCCCAGUCGAGAUGAGCCGGCCGAACAAGGACCGCGGGAAUU.

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1Complex of S-HDAg bound to 86-pRNACOMPLEXall0MULTIPLE SOURCES
2S-HDAgCOMPLEX#11RECOMBINANT
386-pRNACOMPLEX#21SYNTHETIC
Molecular weightExperimental value: NO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
22Hepatitis delta virus12475
33synthetic construct (others)32630
Source (recombinant)Organism: Escherichia coli (E. coli)
Buffer solutionpH: 8 / Details: 20mM Tris-HCl, 200mM NaCl
Buffer component
IDConc.NameFormulaBuffer-ID
120 mMTris(hydroxymethyl)aminomethane hydrochloride1
2200 mMsodium chlorideNaCl1
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 283 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 2500 nm / Nominal defocus min: 700 nm / Alignment procedure: COMA FREE
Specimen holderCryogen: NITROGEN
Image recordingElectron dose: 50 e/Å2 / Film or detector model: FEI FALCON IV (4k x 4k)

-
Processing

EM software
IDNameVersionCategory
1Topaz0.2.5aparticle selection
2EPUimage acquisition
4cryoSPARC4.6.0CTF correction
10cryoSPARC4.6.0initial Euler assignment
11RELION5final Euler assignment
13RELION53D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 1312415 / Details: Topaz (tbepler) particle picking
3D reconstructionResolution: 3.5 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 298422 / Details: Multibody refinement / Symmetry type: POINT
RefinementHighest resolution: 3.5 Å
Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS)
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.0046905
ELECTRON MICROSCOPYf_angle_d0.5969947
ELECTRON MICROSCOPYf_dihedral_angle_d13.4872238
ELECTRON MICROSCOPYf_chiral_restr0.0271225
ELECTRON MICROSCOPYf_plane_restr0.004705

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more