[English] 日本語
Yorodumi
- PDB-9lm3: cryo-EM structure of retron Eco2 -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9lm3
Titlecryo-EM structure of retron Eco2
Components
  • DNA (5'-D(P*GP*GP*A)-3')
  • DNA (67-MER)
  • RNA (5'-R(*GP*UP*GP*CP*CP*UP*GP*CP*AP*UP*GP*CP*GP*U)-3')
  • RNA (62-MER)
  • Retron Ec67 protein
KeywordsRNA BINDING PROTEIN/DNA/RNA / RNA-mediated retron Eco2 oligomerization / RNA BINDING PROTEIN-DNA-RNA complex
Function / homology
Function and homology information


ribonuclease H / RNA-directed DNA polymerase / RNA-directed DNA polymerase activity / RNA-DNA hybrid ribonuclease activity / defense response to virus / RNA binding / metal ion binding
Similarity search - Function
: / RNA-directed DNA polymerase (reverse transcriptase), msDNA / : / Reverse transcriptase domain / Reverse transcriptase (RNA-dependent DNA polymerase) / Reverse transcriptase (RT) catalytic domain profile. / DNA/RNA polymerase superfamily
Similarity search - Domain/homology
: / DNA / DNA (> 10) / RNA / RNA (> 10) / Retron Ec67 protein
Similarity search - Component
Biological speciesEscherichia coli (E. coli)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.6 Å
AuthorsWang, Y.J. / Wang, C. / Guan, Z.Y. / Zou, T.T.
Funding support China, 1items
OrganizationGrant numberCountry
National Natural Science Foundation of China (NSFC) China
CitationJournal: Cell Discov / Year: 2025
Title: Structural basis of the RNA-mediated Retron-Eco2 oligomerization.
Authors: Yanjing Wang / Chen Wang / Yongqi Yin / Yongqing Cui / Zhikang Dai / Chang Liu / Yanke Chen / Zeyuan Guan / Tingting Zou /
Abstract: In the evolutionary arms race between bacteria and viruses, retrons have emerged as distinctive antiphage defense systems. Here, we elucidate the structure and function of Retron-Eco2, which ...In the evolutionary arms race between bacteria and viruses, retrons have emerged as distinctive antiphage defense systems. Here, we elucidate the structure and function of Retron-Eco2, which comprises a non-coding RNA (ncRNA) that encodes multicopy single-stranded DNA (msDNA, a DNA‒RNA hybrid) and a fusion protein containing a reverse transcriptase (RT) domain and a topoisomerase-primase-like (Toprim) effector domain. The Eco2 msDNA and RT-Toprim fusion protein form a 1:1 stoichiometric nucleoprotein complex that further assembles into a trimer (msDNA:RT-Toprim ratio of 3:3) with a distinctive triangular configuration. The RNA portion of the msDNA in one protomer closely intertwines around the RT domain of an adjacent protomer, mediating the formation of this self-inhibitory assembly. Upon activation, the Toprim effector domain exhibits RNase activity, degrading RNA to arrest phage replication. We further reveal that phage mutants evading Eco2-mediated defense harbor mutations in the endonuclease IV-like protein DenB, underscoring DenB's critical role in triggering the activation of this system. Together, these findings provide key structural and functional insights into Retron-Eco2, laying the groundwork for harnessing its potential in biotechnology and synthetic biology applications.
History
DepositionJan 18, 2025Deposition site: PDBJ / Processing site: PDBC
Revision 1.0Sep 17, 2025Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Retron Ec67 protein
E: Retron Ec67 protein
I: Retron Ec67 protein
B: DNA (67-MER)
C: RNA (62-MER)
D: RNA (5'-R(*GP*UP*GP*CP*CP*UP*GP*CP*AP*UP*GP*CP*GP*U)-3')
F: DNA (67-MER)
G: RNA (62-MER)
H: RNA (5'-R(*GP*UP*GP*CP*CP*UP*GP*CP*AP*UP*GP*CP*GP*U)-3')
J: DNA (67-MER)
L: RNA (5'-R(*GP*UP*GP*CP*CP*UP*GP*CP*AP*UP*GP*CP*GP*U)-3')
M: DNA (5'-D(P*GP*GP*A)-3')
N: DNA (5'-D(P*GP*GP*A)-3')
O: DNA (5'-D(P*GP*GP*A)-3')
K: RNA (62-MER)


Theoretical massNumber of molelcules
Total (without water)343,96015
Polymers343,96015
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: Protein Retron Ec67 protein / ORF4-Ec67 RT


Mass: 68673.102 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Gene: ret, Ga0175966_113075, RG66_23265 / Production host: Escherichia coli BL21(DE3) (bacteria)
References: UniProt: P21325, RNA-directed DNA polymerase, ribonuclease H
#2: DNA chain DNA (67-MER)


Mass: 20522.113 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Details: the correct sequence is: TCCTTCGCACAGCACACCTGCCGTATAGCTCTGAATCAAGGATTTTAGGGAGGCGATTCCTCCTGCC.
Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli BL21(DE3) (bacteria)
#3: RNA chain RNA (62-MER)


Mass: 20075.932 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli BL21(DE3) (bacteria) / References: GenBank: 145143
#4: RNA chain RNA (5'-R(*GP*UP*GP*CP*CP*UP*GP*CP*AP*UP*GP*CP*GP*U)-3')


Mass: 4455.668 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli BL21(DE3) (bacteria)
#5: DNA chain DNA (5'-D(P*GP*GP*A)-3')


Mass: 926.661 Da / Num. of mol.: 3
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli BL21(DE3) (bacteria)
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: retron Eco2 / Type: COMPLEX / Entity ID: all / Source: RECOMBINANT
Source (natural)Organism: Escherichia coli (E. coli)
Source (recombinant)Organism: Escherichia coli BL21(DE3) (bacteria)
Buffer solutionpH: 8
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
VitrificationCryogen name: ETHANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal defocus max: 1800 nm / Nominal defocus min: 1200 nm
Image recordingElectron dose: 50 e/Å2 / Film or detector model: GATAN K3 BIOQUANTUM (6k x 4k)

-
Processing

EM softwareName: PHENIX / Version: 1.21.2_5419 / Category: model refinement
CTF correctionType: NONE
3D reconstructionResolution: 2.6 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 574158 / Symmetry type: POINT
RefinementHighest resolution: 2.6 Å
Stereochemistry target values: REAL-SPACE (WEIGHTED MAP SUM AT ATOM CENTERS)
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00419669
ELECTRON MICROSCOPYf_angle_d0.55527537
ELECTRON MICROSCOPYf_dihedral_angle_d23.0724967
ELECTRON MICROSCOPYf_chiral_restr0.043226
ELECTRON MICROSCOPYf_plane_restr0.0042671

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more