[English] 日本語
Yorodumi
- PDB-9hro: Solution NMR structure of the synthetic tobramycin riboswitch in ... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9hro
TitleSolution NMR structure of the synthetic tobramycin riboswitch in complex with tobramycin
ComponentsRNA (35-MER)
KeywordsRNA / RNA-ligand complex / riboswitch / aminoglycoside / translation regulation
Function / homologyTOBRAMYCIN / RNA / RNA (> 10)
Function and homology information
Biological speciessynthetic construct (others)
MethodSOLUTION NMR / distance geometry
AuthorsDuchardt-Ferner, E. / Woehnert, J.
Funding support Germany, 1items
OrganizationGrant numberCountry
German Research Foundation (DFG)SFB902-B17 Germany
Citation
Journal: Nucleic Acids Res. / Year: 2025
Title: Structural basis for ligand recognition in the tobramycin riboswitch.
Authors: Duchardt-Ferner, E. / Kraus, L. / Limouchi, A. / Suess, B. / Wohnert, J.
#1: Journal: Nucleic Acids Res / Year: 2023
Title: Development of a novel tobramycin dependent riboswitch.
Authors: Kraus, L. / Duchardt-Ferner, E. / Braeuchle, E. / Fuerbacher, S. / Kelvin, D. / Marx, H. / Boussebayle, A. / Maurer, L.M. / Bofill-Bosch, C. / Woehnert, J. / Suess, B.
History
DepositionDec 18, 2024Deposition site: PDBE / Processing site: PDBE
Revision 1.0Oct 1, 2025Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: RNA (35-MER)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)11,6572
Polymers11,1901
Non-polymers4681
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: NMR Distance Restraints, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)10 / 100target function
RepresentativeModel #1target function

-
Components

#1: RNA chain RNA (35-MER)


Mass: 11189.646 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) synthetic construct (others) / Production host: Escherichia coli (E. coli)
#2: Chemical ChemComp-TOY / TOBRAMYCIN / 4-AMINO-2-[4,6-DIAMINO-3-(3-AMINO-6-AMINOMETHYL-5-HYDROXY-TETRAHYDRO-PYRAN-2-YLOXY)-2-HYDROXY-CYCLOHEXYLOXY]-6-HYDROXYMETHYL-TETRAHYDRO-PYRAN-3,5-DIOL


Mass: 467.514 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C18H37N5O9 / Feature type: SUBJECT OF INVESTIGATION / Comment: antibiotic*YM
Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDSample stateSpectrometer-IDType
111isotropic62D 1H-1H NOESY
122isotropic12D 1H-15N HSQC imino
132isotropic62D 1H-15N HSQC amino
142isotropic12D HNN-COSY
152isotropic12D CPMG-NOESY
1142isotropic23D 1H-15N NOESY amino
1132isotropic12D long-range 1H-15N HSQC
1177isotropic12D 1H-13C HSQC aromatic
1165isotropic52D 1H-13C HSQC aliphatic
1153isotropic32D H5(C5C4N4)H4
1185isotropic12D H1/H8-C5 HMBC
2374isotropic12D H(CC)H-TOCSY
1195isotropic32D H(N)CO
2206isotropic22D H(C)N aromatic
2214isotropic12D H(C)N aromatic
2226isotropic22D H(C)N aliphatic
2234isotropic12D H(C)N aliphatic
2246isotropic53D 1H-13C NOESY-HSQC aro
2256isotropic33D 1H-13C NOESY-HSQC ali
2264isotropic53D 1H-13C NOESY-HSQC ali
2276isotropic33D (H)CCH-COSY
2284isotropic33D (H)CCH-COSY
2296isotropic33D (H)CCH-TOCSY
2304isotropic33D (H)CCH-TOCSY
1317isotropic12D f1-filtered 1H-1H TOCSY
2328isotropic62D fi1-filtered 1H-1H TOCSY
1349isotropic62D 1H-1H TOCSY
23510isotropic62D 1H-1H TOCSY
1337isotropic12D f1,f2-filtered 1H-1H NOESY
23611isotropic23D HCP

-
Sample preparation

Details
TypeSolution-IDContentsLabelSolvent systemDetails (eV)
solution11 mM unlabeled RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2Ounlabeled sample H2O95% H2O/5% D2O
solution20.5 mM [U-100% 15N] RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O15N labeled sample H2O95% H2O/5% D2O
solution30.75 mM [U-13C; U-15N]-Ade,Cyt RNA (35-MER), 0.9 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2OA,C-13C,15N sample H2O95% H2O/5% D2O
solution40.75 mM [U-13C; U-15N]-Ade,Cyt RNA (35-MER), 0.9 mM unlabeled TOBRAMYCIN, 100% D2OA,C-13C,15N sample D2O100% D2O
solution50.5 mM [U-13C; U-15N]-Ura,Gua RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2OG.U-13C,15N sample H2O95% H2O/5% D2O
solution60.5 mM [U-13C; U-15N]-Ura,Gua RNA (35-MER), 0.6 mM unlabeled TOBRAMYCIN, 100% D2OG.U-13C,15N sample D2O100% D2O
solution70.84 mM [U-13C; U-15N] RNA (35-MER), 1.004 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2O13C,15N sample H2O95% H2O/5% D2O
solution80.84 mM [U-13C; U-15N] RNA (35-MER), 1.004 mM unlabeled TOBRAMYCIN, 100% D2O13C,15N sample D2O100% D2O
solution91 mM [U-100% 2H] RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 95% H2O/5% D2ODeuterated short RNA H2O95% H2O/5% D2O31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC
solution101 mM [U-100% 2H] RNA (35-MER), 1.2 mM unlabeled TOBRAMYCIN, 100% D2ODeuterated short RNA D2O100% D2O31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC
solution112.8 mM [U-13C; U-15N]-Ura RNA (35-MER), 2.2 mM unlabeled TOBRAMYCIN, 100% D2OU-15N,13C short RNA D2O100% D2O31 nt RNA sequence: GGUGUUUCGGACUGUCGGCCUACCGAGCACC
Sample
Conc. (mg/ml)ComponentIsotopic labelingSolution-ID
1 mMRNA (35-MER)unlabeled1
1.2 mMTOBRAMYCINunlabeled1
0.5 mMRNA (35-MER)[U-100% 15N]2
0.6 mMTOBRAMYCINunlabeled2
0.75 mMRNA (35-MER)[U-13C; U-15N]-Ade,Cyt3
0.9 mMTOBRAMYCINunlabeled3
0.75 mMRNA (35-MER)[U-13C; U-15N]-Ade,Cyt4
0.9 mMTOBRAMYCINunlabeled4
0.5 mMRNA (35-MER)[U-13C; U-15N]-Ura,Gua5
0.6 mMTOBRAMYCINunlabeled5
0.5 mMRNA (35-MER)[U-13C; U-15N]-Ura,Gua6
0.6 mMTOBRAMYCINunlabeled6
0.84 mMRNA (35-MER)[U-13C; U-15N]7
1.004 mMTOBRAMYCINunlabeled7
0.84 mMRNA (35-MER)[U-13C; U-15N]8
1.004 mMTOBRAMYCINunlabeled8
1 mMRNA (35-MER)[U-100% 2H]9
1.2 mMTOBRAMYCINunlabeled9
1 mMRNA (35-MER)[U-100% 2H]10
1.2 mMTOBRAMYCINunlabeled10
2.8 mMRNA (35-MER)[U-13C; U-15N]-Ura11
2.2 mMTOBRAMYCINunlabeled11
Sample conditions

Details: 25 mM Potassium Phosphate, 50 mM Potassium Chloride / Ionic strength: 85.9 M / Ionic strength err: 0.5 / pH: 6.2 / PH err: 0.2 / Pressure: 1 bar / Pressure err: 0.01 / Temperature err: 0.1

Conditions-IDLabelTemperature (K)
1NMR Buffer 283 K283 K
2NMR Buffer 298 K298 K

-
NMR measurement

NMR spectrometer
TypeManufacturerModelField strength (MHz)Spectrometer-IDDetails (eV)
Bruker AVANCE NEOBrukerAVANCE NEO60015 mm TCI cryo 1H,15N,13C probe
Bruker AVANCE III HDBrukerAVANCE III HD70025 mm QCI cryo 1H,15N,13C, 31P probe
Bruker AVANCE III HDBrukerAVANCE III HD80035 mm TCI cryo 1H,15N,13C probe
Bruker AVANCE NEOBrukerAVANCE NEO90045 mm TCI cryo 1H,15N,13C probe
Bruker AVANCE IIIBrukerAVANCE III95055 mm TCI cryo 1H,15N,13C probe
Bruker AVANCE IIBrukerAVANCE II60065 mm TCI cryo 1H,15N,13C probe

-
Processing

NMR software
NameDeveloperClassification
TopSpinBruker Biospincollection
TopSpinBruker Biospinprocessing
CARAKeller and Wuthrichchemical shift assignment
CARAKeller and Wuthrichpeak picking
CYANAGuntert, Mumenthaler and Wuthrichstructure calculation
CYANAGuntert, Mumenthaler and Wuthrichrefinement
RefinementMethod: distance geometry / Software ordinal: 5
NMR representativeSelection criteria: target function
NMR ensembleConformer selection criteria: target function / Conformers calculated total number: 100 / Conformers submitted total number: 10

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more