[English] 日本語
Yorodumi
- PDB-9h6t: Partial Cas1-Cas2 CRISPR integrase complex bound to a half-integr... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9h6t
TitlePartial Cas1-Cas2 CRISPR integrase complex bound to a half-integration product, Streptococcus thermophilus DGCC 7710 CRISPR3 system
Components
  • (CRISPR-associated ...) x 2
  • DNA prespacer, the non-integrated strand
  • Fragment of Leader DNA adjacent to the integration site
  • Integration product
  • Integration target DNA, the intact strand
KeywordsDNA BINDING PROTEIN / CIRSPR-Cas / spacer acquisition / Cas1 / Cas2 / CRISPR integrase
Function / homology
Function and homology information


maintenance of CRISPR repeat elements / RNA endonuclease activity / DNA endonuclease activity / defense response to virus / Hydrolases; Acting on ester bonds / DNA binding / metal ion binding
Similarity search - Function
CRISPR-associated protein Cas1, NMENI subtype / CRISPR-associated endonuclease Cas2 / Virulence-associated protein D / CRISPR associated protein Cas2 / CRISPR associated protein Cas2 / : / CRISPR-associated protein Cas1 / CRISPR-associated endonuclease Cas1, C-terminal domain / CRISPR associated protein Cas1
Similarity search - Domain/homology
DNA / DNA (> 10) / CRISPR-associated endonuclease Cas1 / CRISPR-associated endoribonuclease Cas2
Similarity search - Component
Biological speciesStreptococcus thermophilus DGCC 7710 (bacteria)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 2.93 Å
AuthorsSasnauskas, G. / Gaizauskaite, U. / Tamulaitiene, G.
Funding supportLithuania, 1items
OrganizationGrant numberCountry
Research Council of LithuaniaS-MIP-19-32Lithuania
CitationJournal: Mol Cell / Year: 2026
Title: Structural insights into Cas9-mediated prespacer selection in CRISPR-Cas adaptation.
Authors: Ugne Gaizauskaite / Giedre Tamulaitiene / Arunas Silanskas / Giedrius Gasiunas / Virginijus Siksnys / Giedrius Sasnauskas
Abstract: During CRISPR-Cas adaptation, prokaryotic cells become immunized by the insertion of foreign DNA fragments, termed spacers, into the host genome to serve as templates for RNA-guided immunity. Spacer ...During CRISPR-Cas adaptation, prokaryotic cells become immunized by the insertion of foreign DNA fragments, termed spacers, into the host genome to serve as templates for RNA-guided immunity. Spacer acquisition relies on the Cas1-Cas2 integrase and accessory proteins, which select DNA sequences flanked by the protospacer adjacent motif (PAM) and insert them into the CRISPR array. It has been shown that in type II-A systems, selection of PAM-proximal prespacers is mediated by the effector nuclease Cas9, which forms a "supercomplex" with the Cas1-Cas2 integrase and the Csn2 protein. Here, we present cryo-electron microscopy structures of the Streptococcus thermophilus type II-A prespacer selection supercomplex in the DNA-scanning and two distinct PAM-bound configurations, providing insights into the mechanism of Cas9-mediated prespacer selection in type II-A CRISPR-Cas systems. Repurposing Cas9 by the CRISPR adaptation machinery for prespacer selection, as characterized here, demonstrates Cas9 plasticity and expands our knowledge of Cas9 biology.
History
DepositionOct 25, 2024Deposition site: PDBE / Processing site: PDBE
Revision 1.0Feb 18, 2026Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Additional map / Part number: 1 / Data content type: Additional map / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Mask / Part number: 1 / Data content type: Mask / Provider: repository / Type: Initial release
Revision 1.0Feb 18, 2026Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Mar 4, 2026Group: Data collection / Database references / Category: citation / citation_author / em_admin
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 1.1Mar 4, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / EM metadata / Category: citation / citation_author / em_admin
Data content type: EM metadata / EM metadata ...EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata / EM metadata
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year / _em_admin.last_update
Revision 1.2Mar 18, 2026Group: Data collection / Database references / Category: citation / em_admin
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _em_admin.last_update
Revision 1.2Mar 18, 2026Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Database references / Experimental summary / Data content type: EM metadata / EM metadata / Category: citation / em_admin
Data content type: EM metadata / EM metadata ...EM metadata / EM metadata / EM metadata / EM metadata
Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: CRISPR-associated endoribonuclease Cas2
B: CRISPR-associated endonuclease Cas1
C: CRISPR-associated endonuclease Cas1
D: CRISPR-associated endoribonuclease Cas2
E: Fragment of Leader DNA adjacent to the integration site
F: Integration target DNA, the intact strand
G: Integration product
H: DNA prespacer, the non-integrated strand
hetero molecules


Theoretical massNumber of molelcules
Total (without water)144,47310
Polymers144,3938
Non-polymers802
Water00
1


  • Idetical with deposited unit
  • defined by author&software
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1

-
Components

-
CRISPR-associated ... , 2 types, 4 molecules ADBC

#1: Protein CRISPR-associated endoribonuclease Cas2


Mass: 13431.560 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Streptococcus thermophilus DGCC 7710 (bacteria)
Gene: cas2 / Production host: Escherichia coli BL21(DE3) (bacteria)
References: UniProt: G3ECR3, Hydrolases; Acting on ester bonds
#2: Protein CRISPR-associated endonuclease Cas1


Mass: 33863.836 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Streptococcus thermophilus DGCC 7710 (bacteria)
Gene: cas1 / Production host: Escherichia coli BL21(DE3) (bacteria)
References: UniProt: G3ECR2, Hydrolases; Acting on ester bonds

-
DNA chain , 4 types, 4 molecules EFGH

#3: DNA chain Fragment of Leader DNA adjacent to the integration site


Mass: 1833.242 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#4: DNA chain Integration target DNA, the intact strand


Mass: 14835.518 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: TACGAGGTTTTAGAGCTGTGTTGTTTCGAATGGTTCCAAAACCTCGTA / Source: (synth.) synthetic construct (others)
#5: DNA chain Integration product


Mass: 23014.795 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#6: DNA chain DNA prespacer, the non-integrated strand


Mass: 10118.527 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)

-
Non-polymers , 1 types, 2 molecules

#7: Chemical ChemComp-CA / CALCIUM ION


Mass: 40.078 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: Ca

-
Details

Has ligand of interestN
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: Partial Cas1-Cas2 CRISPR integrase complex bound to a half-integration product, Streptococcus thermophilus DGCC 7710 CRISPR3 system
Type: COMPLEX / Entity ID: #1-#6 / Source: RECOMBINANT
Source (natural)Organism: Streptococcus thermophilus DGCC 7710 (bacteria)
Source (recombinant)Organism: Escherichia coli BL21(DE3) (bacteria)
Buffer solutionpH: 7.5
SpecimenEmbedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid mesh size: 300 divisions/in. / Grid type: Quantifoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE

-
Electron microscopy imaging

MicroscopyModel: TFS GLACIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 200 kV / Illumination mode: OTHER
Electron lensMode: BRIGHT FIELD / Nominal magnification: 92000 X / Nominal defocus max: 2000 nm / Nominal defocus min: 1000 nm / Cs: 2.7 mm / C2 aperture diameter: 50 µm
Specimen holderCryogen: NITROGEN
Image recordingAverage exposure time: 46.33 sec. / Electron dose: 30 e/Å2 / Detector mode: COUNTING / Film or detector model: FEI FALCON III (4k x 4k) / Num. of grids imaged: 1

-
Processing

EM software
IDNameVersionCategory
2EPU3.2image acquisition
4cryoSPARCCTF correction
9cryoSPARCinitial Euler assignment
10cryoSPARCfinal Euler assignment
12cryoSPARC4.2.13D reconstruction
13PHENIX1.21.2_5419model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 2.93 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 108374 / Algorithm: FOURIER SPACE / Symmetry type: POINT
Atomic model buildingPDB-ID: 9H1V
Accession code: 9H1V / Source name: PDB / Type: experimental model
RefinementCross valid method: NONE

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more