[English] 日本語
Yorodumi
- PDB-9gvi: Quadruplex-duplex hybrids (QDH) complex with PhenDC3 from PIM1 on... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 9gvi
TitleQuadruplex-duplex hybrids (QDH) complex with PhenDC3 from PIM1 oncogene.
ComponentsDNA (27-MER) complex with ligand (PhenDC3)
KeywordsDNA / G-Quadruplex DNA / PIM1 oncogene / The triple-negative breast cancer
Function / homologyChem-PQ3 / DNA / DNA (> 10)
Function and homology information
Biological speciesHomo sapiens (human)
MethodSOLUTION NMR / simulated annealing
AuthorsGhosh, A. / Lenarcic, M.Z. / Trantirek, L. / Harnos, J.
Funding supportEuropean Union, 1items
OrganizationGrant numberCountry
H2020 Marie Curie Actions of the European Commission101068280European Union
CitationJournal: Nucleic Acids Res. / Year: 2025
Title: Structural basis of bis-quinolinium ligands binding to quadruplex-duplex hybrids from PIM1 oncogene.
Authors: Ghosh, A. / Harnos, J. / Stadlbauer, P. / Sponer, J. / Lenarcic Zivkovic, M. / Trantirek, L.
History
DepositionSep 24, 2024Deposition site: PDBE / Processing site: PDBE
Revision 1.0Aug 27, 2025Provider: repository / Type: Initial release
Revision 1.1Oct 1, 2025Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA (27-MER) complex with ligand (PhenDC3)
hetero molecules


Theoretical massNumber of molelcules
Total (without water)9,0572
Polymers8,5061
Non-polymers5511
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: NMR Distance Restraints, 73 DNA-Ligand Intermolecular NOE restraints
TypeNameSymmetry operationNumber
identity operation1_5551
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)10 / 200structures with the lowest energy
RepresentativeModel #1lowest energy

-
Components

#1: DNA chain DNA (27-MER) complex with ligand (PhenDC3)


Mass: 8506.419 Da / Num. of mol.: 1 / Source method: obtained synthetically / Details: QGCGGGAGGGCGCGCCAGCGGGGTCGGG / Source: (synth.) Homo sapiens (human)
#2: Chemical ChemComp-PQ3 / N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide / Phen-DC3


Mass: 550.609 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C34H26N6O2 / Feature type: SUBJECT OF INVESTIGATION
Has ligand of interestY
Has protein modificationN

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDSample stateSpectrometer-IDType
111isotropic12D 1H-13C HSQC aromatic
121isotropic12D 1H-13C HSQC
131isotropic22D 1H-15N HSQC
141isotropic22D NOESY
151isotropic32D 1H-1H TOCSY
161isotropic32D DQF-COSY

-
Sample preparation

DetailsType: solution
Contents: 500 uM NA SO7-PhenDC3, 200 uM [U-13C; U-15N]-Guanine SO7-PhenDC3, 90% H2O/10% D2O
Details: The samples are buffered with 20 mM KCl and 20 mM potassium phosphate, pH 7.1 in all NMR experiments.
Label: DNA-Ligand complex / Solvent system: 90% H2O/10% D2O
Sample
Conc. (mg/ml)ComponentIsotopic labelingSolution-ID
500 uMSO7-PhenDC3NA1
200 uMSO7-PhenDC3[U-13C; U-15N]-Guanine2
Sample conditionsDetails: The samples are buffered with 20 mM KCl and 20 mM potassium phosphate, pH 7.1 in all NMR experiments.
Ionic strength: 20 mM / Label: condition_1 / pH: 7.1 / Pressure: 1 atm / Temperature: 298.2 K

-
NMR measurement

NMR spectrometer
TypeManufacturerModelField strength (MHz)Spectrometer-ID
Bruker AVANCE NEOBrukerAVANCE NEO9501
Bruker AVANCE NEOBrukerAVANCE NEO8502
Bruker AVANCE NEOBrukerAVANCE NEO6003

-
Processing

NMR software
NameVersionDeveloperClassification
NMRFAM-SPARKY1.414Woonghee Lee, Marco Tonelli, and John L. Markleychemical shift assignment
Amber22Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollmanstructure calculation
Amber22Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollmanrefinement
NMRFAM-SPARKY1.414Woonghee Lee, Marco Tonelli, and John L. Markleypeak picking
RefinementMethod: simulated annealing / Software ordinal: 3
NMR representativeSelection criteria: lowest energy
NMR ensembleConformer selection criteria: structures with the lowest energy
Conformers calculated total number: 200 / Conformers submitted total number: 10

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more