[English] 日本語
Yorodumi
- PDB-8fw7: Histone from Bdellovibrio bacteriovorus bound to dsDNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8fw7
TitleHistone from Bdellovibrio bacteriovorus bound to dsDNA
Components
  • CBFD_NFYB_HMF domain-containing protein
  • DNA (5'-D(P*AP*T)-3')
  • DNA (5'-D(P*CP*AP*T)-3')
KeywordsDNA BINDING PROTEIN/DNA / Histone / nucleosome / scaffold / DNA BINDING PROTEIN / DNA BINDING PROTEIN-DNA complex
Function / homologyTranscription factor CBF/NF-Y/archaeal histone domain / Histone-like transcription factor (CBF/NF-Y) and archaeal histone / Histone-fold / protein heterodimerization activity / DNA / Transcription factor CBF/NF-Y/archaeal histone domain-containing protein
Function and homology information
Biological speciesBdellovibrio bacteriovorus HD100 (bacteria)
synthetic construct (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 2 Å
AuthorsLaursen, S.P. / Luger, K.
Funding support United States, 1items
OrganizationGrant numberCountry
Howard Hughes Medical Institute (HHMI) United States
CitationJournal: Nat Microbiol / Year: 2023
Title: Histones with an unconventional DNA-binding mode in vitro are major chromatin constituents in the bacterium Bdellovibrio bacteriovorus.
Authors: Hocher, A. / Laursen, S.P. / Radford, P. / Tyson, J. / Lambert, C. / Stevens, K.M. / Montoya, A. / Shliaha, P.V. / Picardeau, M. / Sockett, R.E. / Luger, K. / Warnecke, T.
History
DepositionJan 20, 2023Deposition site: RCSB / Processing site: RCSB
Revision 1.0Aug 30, 2023Provider: repository / Type: Initial release
Revision 1.1Mar 13, 2024Group: Database references / Category: citation / citation_author
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DNA (5'-D(P*CP*AP*T)-3')
D: CBFD_NFYB_HMF domain-containing protein
H: CBFD_NFYB_HMF domain-containing protein
B: DNA (5'-D(P*AP*T)-3')


Theoretical massNumber of molelcules
Total (without water)15,4234
Polymers15,4234
Non-polymers00
Water93752
1
A: DNA (5'-D(P*CP*AP*T)-3')
D: CBFD_NFYB_HMF domain-containing protein
H: CBFD_NFYB_HMF domain-containing protein
B: DNA (5'-D(P*AP*T)-3')

A: DNA (5'-D(P*CP*AP*T)-3')
D: CBFD_NFYB_HMF domain-containing protein
H: CBFD_NFYB_HMF domain-containing protein
B: DNA (5'-D(P*AP*T)-3')

A: DNA (5'-D(P*CP*AP*T)-3')
D: CBFD_NFYB_HMF domain-containing protein
H: CBFD_NFYB_HMF domain-containing protein
B: DNA (5'-D(P*AP*T)-3')

A: DNA (5'-D(P*CP*AP*T)-3')
D: CBFD_NFYB_HMF domain-containing protein
H: CBFD_NFYB_HMF domain-containing protein
B: DNA (5'-D(P*AP*T)-3')


Theoretical massNumber of molelcules
Total (without water)61,69116
Polymers61,69116
Non-polymers00
Water28816
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
crystal symmetry operation4_445x-1/2,-y-1/2,-z1
crystal symmetry operation6_545-x,-y-1/2,z1
crystal symmetry operation7_555-x+1/2,y,-z1
Unit cell
Length a, b, c (Å)33.081, 103.143, 111.145
Angle α, β, γ (deg.)90.000, 90.000, 90.000
Int Tables number24
Space group name H-MI212121
Space group name HallI2b2c
Symmetry operation#1: x,y,z
#2: x,-y,-z+1/2
#3: -x+1/2,y,-z
#4: -x,-y+1/2,z
#5: x+1/2,y+1/2,z+1/2
#6: x+1/2,-y+1/2,-z+1
#7: -x+1,y+1/2,-z+1/2
#8: -x+1/2,-y+1,z+1/2
Components on special symmetry positions
IDModelComponents
11A-101-

HOH

-
Components

#1: DNA chain DNA (5'-D(P*CP*AP*T)-3')


Mass: 861.624 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#2: Protein CBFD_NFYB_HMF domain-containing protein


Mass: 6994.307 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Bdellovibrio bacteriovorus HD100 (bacteria)
Gene: Bd0055 / Production host: Escherichia coli (E. coli) / References: UniProt: Q6MRM1
#3: DNA chain DNA (5'-D(P*AP*T)-3')


Mass: 572.442 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#4: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 52 / Source method: isolated from a natural source / Formula: H2O
Sequence detailsThe authors state that the complex was crystallized with 35 bp of dsDNA ...The authors state that the complex was crystallized with 35 bp of dsDNA (TCTTGCACTAAGAGCTACTGGAGTGCGTCAGATGT). The continuous helix can be built using crystallographic symmetry of 5 ambiguous bases.

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.13 Å3/Da / Density % sol: 60.66 % / Description: Cubic
Crystal growTemperature: 293 K / Method: vapor diffusion, hanging drop / pH: 8 / Details: 15% PEG 550 MME, 50 mM HEPES

-
Data collection

DiffractionMean temperature: 100 K / Serial crystal experiment: N
Diffraction sourceSource: SYNCHROTRON / Site: ALS / Beamline: 8.2.1 / Wavelength: 1.00004 Å
DetectorType: ADSC QUANTUM 315r / Detector: CCD / Date: May 5, 2022
RadiationMonochromator: Double-crystal Si(111) and multilayer / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1.00004 Å / Relative weight: 1
ReflectionResolution: 2→27.79 Å / Num. obs: 13147 / % possible obs: 98.37 % / Redundancy: 7.1 % / Biso Wilson estimate: 35.83 Å2 / CC1/2: 0.999 / CC star: 1 / Rmerge(I) obs: 0.06045 / Rpim(I) all: 0.0249 / Rrim(I) all: 0.06554 / Net I/σ(I): 16.49
Reflection shellResolution: 2→2.072 Å / Redundancy: 7.4 % / Rmerge(I) obs: 0.5857 / Mean I/σ(I) obs: 3.86 / Num. unique obs: 1302 / CC1/2: 0.908 / CC star: 0.976 / Rpim(I) all: 0.2299 / Rrim(I) all: 0.6299 / % possible all: 97.89

-
Processing

Software
NameVersionClassification
XDSdata reduction
Aimlessdata scaling
PHASERphasing
PHENIX1.20.1_4487refinement
RefinementMethod to determine structure: MOLECULAR REPLACEMENT / Resolution: 2→27.79 Å / SU ML: 0.2063 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 25.6993
Stereochemistry target values: GeoStd + Monomer Library + CDL v1.2
RfactorNum. reflection% reflection
Rfree0.2539 1317 10.03 %
Rwork0.2217 11819 -
obs0.2249 13136 98.43 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.1 Å / Solvent model: FLAT BULK SOLVENT MODEL
Displacement parametersBiso mean: 44.74 Å2
Refinement stepCycle: LAST / Resolution: 2→27.79 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms952 99 0 52 1103
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.00761061
X-RAY DIFFRACTIONf_angle_d0.91921434
X-RAY DIFFRACTIONf_chiral_restr0.0867184
X-RAY DIFFRACTIONf_plane_restr0.005159
X-RAY DIFFRACTIONf_dihedral_angle_d17.8815170
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
2-2.080.26261530.23021292X-RAY DIFFRACTION98.1
2.08-2.170.29421290.23781308X-RAY DIFFRACTION99.93
2.17-2.290.29231460.22911293X-RAY DIFFRACTION98.63
2.29-2.430.28381440.24211299X-RAY DIFFRACTION99.04
2.43-2.620.29491480.2491302X-RAY DIFFRACTION99.38
2.62-2.880.26351460.2451332X-RAY DIFFRACTION99.53
2.88-3.30.27451480.24731319X-RAY DIFFRACTION98.92
3.3-4.150.25681490.21351328X-RAY DIFFRACTION98.01
4.16-27.790.21981540.19881346X-RAY DIFFRACTION94.76

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlvh1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more