[English] 日本語
Yorodumi
- PDB-8cq1: Stem-Loop 4 of the 5'-UTR of the SARS-CoV2 genomic RNA -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 8cq1
TitleStem-Loop 4 of the 5'-UTR of the SARS-CoV2 genomic RNA
Components5_SL4
KeywordsRNA / SARS-CoV2 / Stem-Loop
Function / homologyRNA / RNA (> 10)
Function and homology information
Biological speciesSevere acute respiratory syndrome coronavirus 2
MethodSOLUTION NMR / na / torsion angle dynamics / molecular dynamics
AuthorsDuchardt-Ferner, E. / Voegele, J.
Funding support Germany, 1items
OrganizationGrant numberCountry
German Research Foundation (DFG)CRC902 Germany
CitationJournal: Nucleic Acids Res. / Year: 2023
Title: High-resolution structure of stem-loop 4 from the 5'-UTR of SARS-CoV-2 solved by solution state NMR.
Authors: Vogele, J. / Hymon, D. / Martins, J. / Ferner, J. / Jonker, H.R.A. / Hargrove, A.E. / Weigand, J.E. / Wacker, A. / Schwalbe, H. / Wohnert, J. / Duchardt-Ferner, E.
History
DepositionMar 3, 2023Deposition site: PDBE / Processing site: PDBE
Revision 1.0Sep 20, 2023Provider: repository / Type: Initial release
Revision 1.1Oct 18, 2023Group: Database references / Category: citation / citation_author
Item: _citation.pdbx_database_id_PubMed / _citation.title ..._citation.pdbx_database_id_PubMed / _citation.title / _citation_author.identifier_ORCID / _citation_author.name
Revision 1.2Nov 22, 2023Group: Database references / Category: citation
Item: _citation.journal_volume / _citation.page_first / _citation.page_last

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: 5_SL4


Theoretical massNumber of molelcules
Total (without water)14,0741
Polymers14,0741
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: SAXS
TypeNameSymmetry operationNumber
identity operation1_5551
NMR ensembles
DataCriteria
Number of conformers (submitted / calculated)10 / 100target function
RepresentativeModel #1target function

-
Components

#1: RNA chain 5_SL4


Mass: 14074.320 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Severe acute respiratory syndrome coronavirus 2
Production host: Escherichia coli (E. coli)

-
Experimental details

-
Experiment

ExperimentMethod: SOLUTION NMR
NMR experiment
Conditions-IDExperiment-IDSolution-IDSample stateSpectrometer-IDType
111isotropic22D 1H-1H NOESY
181isotropic3NOESY[15N]-CPMG
1104isotropic2NOESY[15N]-CPMG
222isotropic73D 1H-13C NOESY aliphatic
242isotropic23D 13C,15N-filtered 1H-13C NOESY aromatic
132isotropic43D 1H-13C NOESY aromatic
253isotropic33D 1H-13C NOESY aliphatic
263isotropic33D 1H-13C NOESY aromatic
272isotropic23D 13C,15N-filtered 1H-13C NOESY aliphatic
1209isotropic72D 1H-1H NOESY
2114isotropic23D 1H-13C NOESY aromatic
2124isotropic63D 1H-13C NOESY aliphatic
1138isotropic31H,15N-IPAP-SOFAST-HMQC
1147anisotropic31H,15N-IPAP-SOFAST-HMQC
1158isotropic31H,13C-IPAP-HSQC
1167anisotropic31H,13C-IPAP-HSQC
1176isotropic31H,13C-IPAP-HSQC
1185anisotropic31H,13C-IPAP-HSQC
1211isotropic7lr HNN-COSY
1221isotropic3HNN-COSY
2233isotropic23D (H)CCH-TOCSY
2242isotropic23D (H)CCH-TOCSY
2252isotropic63D (H)CCH-TOCSY
2263isotropic63D (H)CCH-COSY
2272isotropic63D (H)CCH-COSY
1283isotropic33D (H)CNC
1292isotropic33D (H)CNC
1302isotropic32D Best-TROSY H(N)CO
2312isotropic82D H5(C5)C4

-
Sample preparation

Details
TypeSolution-IDContentsLabelSolvent systemDetails
solution1500 uM [U-100% 15N] 5_SL4 RNA, 95% H2O/5% D2O15N_sample95% H2O/5% D2O
solution2500 uM [U-13C; U-15N]-Ura,Gua 5_SL4 RNA, 95% H2O/5% D2OG,U-13C,15N_sample95% H2O/5% D2O
solution3500 uM [U-13C; U-15N]-Ade,Cyt 5_SL4 RNA, 95% H2O/5% D2OA,C-13C,15N_sample95% H2O/5% D2O
solution4350 uM [U-13C; U-15N] 5_SL4sh RNA, 95% H2O/5% D2O5_SL4sh 13C,15N_sample95% H2O/5% D2Osequence GGCACUCGGCUGCAUGCUUAGUGCC
solution91.8 mM 5_SL4sh RNA, 95% H2O/5% D2O5_SL4sh unlabeled_sample95% H2O/5% D2Osequence GGCACUCGGCUGCAUGCUUAGUGCC
solution5200 uM [U-13C; U-15N]-Ade,Cyt 5_SL4 RNA, 11.6 mg/mL unlabeled Pf1 phage, 95% H2O/5% D2O5_SL4 A,C 13C,15N RDC95% H2O/5% D2O
solution7200 uM [U-13C; U-15N]-Gua,Ury 5_SL4 RNA, 11.6 uM unlabeled Pf1 phage, 95% H2O/5% D2O5_SL4 G,U 13C,15N RDC95% H2O/5% D2O
solution6200 uM [U-13C; U-15N]-Ade,Cyt 5_SL4 RNA, 95% H2O/5% D2O5_SL4 A,C 13C,15N RDC reference95% H2O/5% D2O
solution8200 uM [U-13C; U-15N]-Gua,Ura 5_SL4 RNA, 95% H2O/5% D2O5_SL4 G,U 13C,15N RDC reference95% H2O/5% D2O
Sample
Conc. (mg/ml)ComponentIsotopic labelingSolution-ID
500 uM5_SL4 RNA[U-100% 15N]1
500 uM5_SL4 RNA[U-13C; U-15N]-Ura,Gua2
500 uM5_SL4 RNA[U-13C; U-15N]-Ade,Cyt3
350 uM5_SL4sh RNA[U-13C; U-15N]4
1.8 mM5_SL4sh RNAnatural abundance9
200 uM5_SL4 RNA[U-13C; U-15N]-Ade,Cyt5
11.6 mg/mLPf1 phageunlabeled5
200 uM5_SL4 RNA[U-13C; U-15N]-Gua,Ury7
11.6 uMPf1 phageunlabeled7
200 uM5_SL4 RNA[U-13C; U-15N]-Ade,Cyt6
200 uM5_SL4 RNA[U-13C; U-15N]-Gua,Ura8
Sample conditions

Details: 25 mM potassium phosphate buffer 50 mM potassium chloride / Ionic strength: 100 mM / Label: conditions_1 / pH: 6.2 / PH err: 0.05 / Pressure: 1 bar

Conditions-IDTemperature (K)
1283 K
2298 K

-
NMR measurement

NMR spectrometer
TypeManufacturerModelField strength (MHz)Spectrometer-IDDetails
Bruker AVANCE NEOBrukerAVANCE NEO6001TCI-N cryogenic probe
Bruker AVANCE III HDBrukerAVANCE III HD8002TCI-N cryogenic probe
Bruker AVANCE IIBrukerAVANCE II8003TXO cryogenic probe
Bruker AVANCEBrukerAVANCE6004TCI-N cryogenic probe
Bruker AVANCE III HDBrukerAVANCE III HD7005QCI-P cryogenic probe
Bruker AVANCE III HDBrukerAVANCE III HD6006TCI-N cryoprobe prodigy
Bruker AVANCE IIIBrukerAVANCE III9507TCI-N cryogenic probe
Bruker AVANCE NEOBrukerAVANCE NEO9008TCI-N cryogenic Probe

-
Processing

NMR software
NameDeveloperClassification
TopSpinBruker Biospincollection
CYANAGuntert, Mumenthaler and Wuthrichstructure calculation
CARAKeller and Wuthrichchemical shift assignment
ARIALinge, O'Donoghue and Nilgesrefinement
Refinement
MethodSoftware ordinalDetails
na1
na3
torsion angle dynamics2
molecular dynamics4refinement in water
NMR representativeSelection criteria: target function
NMR ensembleConformer selection criteria: target function / Conformers calculated total number: 100 / Conformers submitted total number: 10

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more