[English] 日本語
![](img/lk-miru.gif)
- PDB-7z6h: Structure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 che... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 7z6h | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Structure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp | |||||||||
![]() |
| |||||||||
![]() | DNA BINDING PROTEIN / DNA damage checkpoint / Rad17-RFC / 9-1-1 | |||||||||
Function / homology | ![]() meiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / response to organophosphorus / Ctf18 RFC-like complex / Rad17 RFC-like complex / DNA replication factor C complex / Elg1 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Polymerase switching ...meiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / response to organophosphorus / Ctf18 RFC-like complex / Rad17 RFC-like complex / DNA replication factor C complex / Elg1 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Polymerase switching / DNA clamp loader activity / double-stranded DNA 3'-5' DNA exonuclease activity / exodeoxyribonuclease III / DNA replication checkpoint signaling / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage / regulation of phosphorylation / Polymerase switching on the C-strand of the telomere / mitotic DNA replication checkpoint signaling / mitotic intra-S DNA damage checkpoint signaling / embryo development ending in birth or egg hatching / DNA duplex unwinding / HDR through Single Strand Annealing (SSA) / Impaired BRCA2 binding to RAD51 / DNA strand elongation involved in DNA replication / DNA synthesis involved in DNA repair / negative regulation of DNA replication / Presynaptic phase of homologous DNA pairing and strand exchange / PCNA-Dependent Long Patch Base Excision Repair / ATP-dependent activity, acting on DNA / Activation of ATR in response to replication stress / response to UV / substantia nigra development / 3'-5' exonuclease activity / telomere maintenance / Translesion synthesis by REV1 / Translesion synthesis by POLK / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / DNA damage checkpoint signaling / cellular response to ionizing radiation / nucleotide-excision repair / Recognition of DNA damage by PCNA-containing replication complex / Termination of translesion DNA synthesis / regulation of protein phosphorylation / Translesion Synthesis by POLH / double-strand break repair via homologous recombination / HDR through Homologous Recombination (HRR) / G2/M DNA damage checkpoint / Dual Incision in GG-NER / DNA-templated DNA replication / histone deacetylase binding / SH3 domain binding / Dual incision in TC-NER / Gap-filling DNA repair synthesis and ligation in TC-NER / intrinsic apoptotic signaling pathway in response to DNA damage / chromosome / site of double-strand break / Processing of DNA double-strand break ends / DNA replication / Regulation of TP53 Activity through Phosphorylation / damaged DNA binding / intracellular membrane-bounded organelle / DNA repair / DNA damage response / chromatin binding / nucleolus / protein kinase binding / enzyme binding / ATP hydrolysis activity / DNA binding / nucleoplasm / ATP binding / nucleus / cytoplasm / cytosol Similarity search - Function | |||||||||
Biological species | ![]() synthetic construct (others) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.59 Å | |||||||||
![]() | Day, M. / Oliver, A.W. / Pearl, L.H. | |||||||||
Funding support | ![]()
| |||||||||
![]() | ![]() Title: Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction. Authors: Matthew Day / Antony W Oliver / Laurence H Pearl / ![]() Abstract: The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or ...The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or resection of DNA double strand breaks. Loaded at the 5'-recessed end of a dsDNA-ssDNA junction by the RAD17-RFC clamp loader complex, the phosphorylated C-terminal tail of the RAD9 subunit of 9-1-1 engages with the mediator scaffold TOPBP1 which in turn activates the ATR kinase, localised through the interaction of its constitutive partner ATRIP with RPA-coated ssDNA. Using cryogenic electron microscopy (cryoEM) we have determined the structure of a complex of the human RAD17-RFC clamp loader bound to human 9-1-1, engaged with a dsDNA-ssDNA junction. The structure answers the key questions of how RAD17 confers specificity for 9-1-1 over PCNA, and how the clamp loader specifically recognises the recessed 5' DNA end and fixes the orientation of 9-1-1 on the ssDNA. | |||||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 494 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 379.9 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 1.5 MB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 1.5 MB | Display | |
Data in XML | ![]() | 73.5 KB | Display | |
Data in CIF | ![]() | 103.9 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 14527MC M: map data used to model this data C: citing same article ( |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
EM raw data | ![]() Data size: 4.4 TB Data #1: unaligned multiframe EER movies for human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction [micrographs - multiframe]) |
-
Links
-
Assembly
Deposited unit | ![]()
|
---|---|
1 |
|
-
Components
-Cell cycle checkpoint ... , 2 types, 3 molecules ABK
#1: Protein | Mass: 44260.023 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
---|---|
#2: Protein | Mass: 115195.578 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() References: UniProt: O60671, UniProt: O75943, exodeoxyribonuclease III |
-Replication factor C subunit ... , 4 types, 4 molecules DEFG
#4: Protein | Mass: 39719.648 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
---|---|
#5: Protein | Mass: 40614.332 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
#6: Protein | Mass: 39203.207 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
#7: Protein | Mass: 40688.816 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() |
-Protein / DNA chain / Non-polymers , 3 types, 8 molecules CXY![](data/chem/img/AGS.gif)
![](data/chem/img/AGS.gif)
#3: Protein | Mass: 31731.854 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() | ||
---|---|---|---|
#8: DNA chain | Mass: 23761.232 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped ...Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped with a tetraloop at one end, and with a 24 nucleotide 3' overhang Source: (synth.) synthetic construct (others) #9: Chemical | ChemComp-AGS / |
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
Component | Name: DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp Type: COMPLEX / Entity ID: #1-#8 / Source: RECOMBINANT |
---|---|
Molecular weight | Value: 0.35 MDa / Experimental value: NO |
Source (natural) | Organism: ![]() |
Source (recombinant) | Organism: ![]() ![]() |
Buffer solution | pH: 7.5 |
Specimen | Conc.: 0.21 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
Specimen support | Grid material: COPPER / Grid type: Quantifoil R1.2/1.3 |
Vitrification | Cryogen name: ETHANE-PROPANE |
-
Electron microscopy imaging
Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: ![]() |
Electron lens | Mode: OTHER / Nominal defocus max: 2500 nm / Nominal defocus min: 1500 nm |
Image recording | Electron dose: 34.9 e/Å2 / Film or detector model: FEI FALCON IV (4k x 4k) |
-
Processing
Software | Name: PHENIX / Version: 1.20.1_4487: / Classification: refinement | ||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
3D reconstruction | Resolution: 3.59 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 150626 / Num. of class averages: 1 / Symmetry type: POINT | ||||||||||||||||||||||||
Refine LS restraints |
|