[English] 日本語
Yorodumi- PDB-7z6h: Structure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 che... -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 7z6h | |||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Structure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp | |||||||||||||||||||||||||||||||||||||||
Components |
| |||||||||||||||||||||||||||||||||||||||
Keywords | DNA BINDING PROTEIN / DNA damage checkpoint / Rad17-RFC / 9-1-1 | |||||||||||||||||||||||||||||||||||||||
| Function / homology | Function and homology informationmeiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / Rad17 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Elg1 RFC-like complex / DNA replication factor C complex / Ctf18 RFC-like complex / regulation of phosphorylation / exodeoxyribonuclease III ...meiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / Rad17 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Elg1 RFC-like complex / DNA replication factor C complex / Ctf18 RFC-like complex / regulation of phosphorylation / exodeoxyribonuclease III / DNA clamp loader activity / double-stranded DNA 3'-5' DNA exonuclease activity / Polymerase switching / DNA replication checkpoint signaling / 3'-5'-DNA exonuclease activity / embryo development ending in birth or egg hatching / mitotic DNA replication checkpoint signaling / protein localization to site of double-strand break / Polymerase switching on the C-strand of the telomere / chromatin-protein adaptor activity / positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage / mitotic intra-S DNA damage checkpoint signaling / DNA strand elongation involved in DNA replication / HDR through Single Strand Annealing (SSA) / negative regulation of DNA replication / Impaired BRCA2 binding to RAD51 / DNA synthesis involved in DNA repair / Presynaptic phase of homologous DNA pairing and strand exchange / PCNA-Dependent Long Patch Base Excision Repair / ATP-dependent activity, acting on DNA / Activation of ATR in response to replication stress / response to UV / substantia nigra development / telomere maintenance / DNA damage checkpoint signaling / Translesion synthesis by REV1 / Translesion synthesis by POLK / Translesion synthesis by POLI / cellular response to ionizing radiation / Gap-filling DNA repair synthesis and ligation in GG-NER / nucleotide-excision repair / Termination of translesion DNA synthesis / Translesion Synthesis by POLH / Recognition of DNA damage by PCNA-containing replication complex / SH3 domain binding / G2/M DNA damage checkpoint / double-strand break repair via homologous recombination / DNA-templated DNA replication / HDR through Homologous Recombination (HRR) / Dual Incision in GG-NER / intrinsic apoptotic signaling pathway in response to DNA damage / histone deacetylase binding / Dual incision in TC-NER / Gap-filling DNA repair synthesis and ligation in TC-NER / chromosome / site of double-strand break / Processing of DNA double-strand break ends / Regulation of TP53 Activity through Phosphorylation / damaged DNA binding / DNA replication / DNA repair / DNA damage response / chromatin binding / protein kinase binding / nucleolus / enzyme binding / ATP hydrolysis activity / DNA binding / nucleoplasm / ATP binding / nucleus / cytoplasm / cytosol Similarity search - Function | |||||||||||||||||||||||||||||||||||||||
| Biological species | Homo sapiens (human)synthetic construct (others) | |||||||||||||||||||||||||||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.59 Å | |||||||||||||||||||||||||||||||||||||||
Authors | Day, M. / Oliver, A.W. / Pearl, L.H. | |||||||||||||||||||||||||||||||||||||||
| Funding support | United Kingdom, 2items
| |||||||||||||||||||||||||||||||||||||||
Citation | Journal: Nucleic Acids Res / Year: 2022Title: Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction. Authors: Matthew Day / Antony W Oliver / Laurence H Pearl / ![]() Abstract: The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or ...The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or resection of DNA double strand breaks. Loaded at the 5'-recessed end of a dsDNA-ssDNA junction by the RAD17-RFC clamp loader complex, the phosphorylated C-terminal tail of the RAD9 subunit of 9-1-1 engages with the mediator scaffold TOPBP1 which in turn activates the ATR kinase, localised through the interaction of its constitutive partner ATRIP with RPA-coated ssDNA. Using cryogenic electron microscopy (cryoEM) we have determined the structure of a complex of the human RAD17-RFC clamp loader bound to human 9-1-1, engaged with a dsDNA-ssDNA junction. The structure answers the key questions of how RAD17 confers specificity for 9-1-1 over PCNA, and how the clamp loader specifically recognises the recessed 5' DNA end and fixes the orientation of 9-1-1 on the ssDNA. | |||||||||||||||||||||||||||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 7z6h.cif.gz | 501 KB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb7z6h.ent.gz | 379.8 KB | Display | PDB format |
| PDBx/mmJSON format | 7z6h.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/z6/7z6h ftp://data.pdbj.org/pub/pdb/validation_reports/z6/7z6h | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 14527MC M: map data used to model this data C: citing same article ( |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
| EM raw data | EMPIAR-11062 (Title: Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junctionData size: 4.4 TB Data #1: unaligned multiframe EER movies for human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction [micrographs - multiframe]) |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-Cell cycle checkpoint ... , 2 types, 3 molecules ABK
| #1: Protein | Mass: 44260.023 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD9A / Production host: ![]() |
|---|---|
| #2: Protein | Mass: 115195.578 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RAD1, REC1, RAD17, R24L / Production host: ![]() References: UniProt: O60671, UniProt: O75943, exodeoxyribonuclease III |
-Replication factor C subunit ... , 4 types, 4 molecules DEFG
| #4: Protein | Mass: 39719.648 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RFC4 / Production host: ![]() |
|---|---|
| #5: Protein | Mass: 40614.332 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RFC3 / Production host: ![]() |
| #6: Protein | Mass: 39203.207 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RFC2 / Production host: ![]() |
| #7: Protein | Mass: 40688.816 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RFC5 / Production host: ![]() |
-Protein / DNA chain / Non-polymers , 3 types, 8 molecules CXY

| #3: Protein | Mass: 31731.854 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: HUS1 / Production host: ![]() | ||
|---|---|---|---|
| #8: DNA chain | Mass: 23761.232 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped ...Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped with a tetraloop at one end, and with a 24 nucleotide 3' overhang Source: (synth.) synthetic construct (others) #9: Chemical | ChemComp-AGS / |
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp Type: COMPLEX / Entity ID: #1-#8 / Source: RECOMBINANT |
|---|---|
| Molecular weight | Value: 0.35 MDa / Experimental value: NO |
| Source (natural) | Organism: Homo sapiens (human) |
| Source (recombinant) | Organism: ![]() |
| Buffer solution | pH: 7.5 |
| Specimen | Conc.: 0.21 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Specimen support | Grid material: COPPER / Grid type: Quantifoil R1.2/1.3 |
| Vitrification | Cryogen name: ETHANE-PROPANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Titan Krios / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TITAN KRIOS |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: OTHER / Nominal defocus max: 2500 nm / Nominal defocus min: 1500 nm |
| Image recording | Electron dose: 34.9 e/Å2 / Film or detector model: FEI FALCON IV (4k x 4k) |
-
Processing
| Software | Name: PHENIX / Version: 1.20.1_4487: / Classification: refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| EM software | Name: PHENIX / Category: model refinement | ||||||||||||||||||||||||
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.59 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 150626 / Num. of class averages: 1 / Symmetry type: POINT | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Homo sapiens (human)
United Kingdom, 2items
Citation
PDBj











































gel filtration

