[English] 日本語
![](img/lk-miru.gif)
- PDB-7q7z: Crystal structure of the methyltransferase-ribozyme 1 (with 1-ben... -
+
Open data
-
Basic information
Entry | Database: PDB / ID: 7q7z | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of the methyltransferase-ribozyme 1 (with 1-benzylamine-adenosine) | ||||||
![]() |
| ||||||
![]() | RNA / MTR1 / methyltransferase ribozyme / ribozyme | ||||||
Function / homology | GUANINE / RNA / RNA (> 10)![]() | ||||||
Biological species | synthetic construct (others) | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Mieczkowski, M. / Hoebartner, C. | ||||||
Funding support | European Union, 1items
| ||||||
![]() | ![]() Title: Structure and mechanism of the methyltransferase ribozyme MTR1. Authors: Scheitl, C.P.M. / Mieczkowski, M. / Schindelin, H. / Hobartner, C. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 149 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 119.5 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 438.6 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 441 KB | Display | |
Data in XML | ![]() | 6.4 KB | Display | |
Data in CIF | ![]() | 8 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 7q7xSC ![]() 7q7yC ![]() 7q80C ![]() 7q81C ![]() 7q82C S: Starting model for refinement C: citing same article ( |
---|---|
Similar structure data | Similarity search - Function & homology ![]() |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 | ![]()
| ||||||||
2 | ![]()
| ||||||||
Unit cell |
|
-
Components
-RNA chain , 3 types, 6 molecules ADBECF
#1: RNA chain | Mass: 4542.855 Da / Num. of mol.: 2 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #2: RNA chain | Mass: 7641.636 Da / Num. of mol.: 2 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #3: RNA chain | Mass: 7755.703 Da / Num. of mol.: 2 / Source method: obtained synthetically / Details: GCUGGGACAACUAGACAUACAGUG / Source: (synth.) synthetic construct (others) |
---|
-Non-polymers , 3 types, 11 molecules ![](data/chem/img/MG.gif)
![](data/chem/img/GUN.gif)
![](data/chem/img/HOH.gif)
![](data/chem/img/GUN.gif)
![](data/chem/img/HOH.gif)
#4: Chemical | #5: Chemical | #6: Water | ChemComp-HOH / | |
---|
-Details
Has ligand of interest | Y |
---|
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 3.63 Å3/Da / Density % sol: 66.07 % |
---|---|
Crystal grow | Temperature: 293 K / Method: vapor diffusion Details: 36-42% MPD, 50mM MES pH 6.4-6.7, 100mM NaCl, 100mM LiCl, 10mM MgCl2 |
-Data collection
Diffraction | Mean temperature: 100 K / Serial crystal experiment: N |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: DECTRIS EIGER X 16M / Detector: PIXEL / Date: Mar 30, 2021 |
Radiation | Monochromator: M / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1.0332 Å / Relative weight: 1 |
Reflection | Resolution: 3.26→44.54 Å / Num. obs: 9584 / % possible obs: 99.71 % / Redundancy: 15.4 % / CC1/2: 0.995 / Rmerge(I) obs: 0.14 / Net I/σ(I): 11.9 |
Reflection shell | Resolution: 3.26→3.38 Å / Mean I/σ(I) obs: 0.6 / Num. unique obs: 937 / CC1/2: 0.236 / % possible all: 98.83 |
-
Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: 7Q7X Resolution: 3.26→44.54 Å / SU ML: 0.5 / Cross valid method: FREE R-VALUE / σ(F): 1.33 / Phase error: 34.66 / Stereochemistry target values: ML
| ||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | ||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.26→44.54 Å
| ||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| ||||||||||||||||||||||||||||||||||||||||
LS refinement shell |
| ||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Origin x: 20.4042 Å / Origin y: -41.2435 Å / Origin z: -8.9227 Å
| ||||||||||||||||||||||||||||||||||||||||
Refinement TLS group | Selection details: all |