[English] 日本語
Yorodumi
- PDB-7q7z: Crystal structure of the methyltransferase-ribozyme 1 (with 1-ben... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7q7z
TitleCrystal structure of the methyltransferase-ribozyme 1 (with 1-benzylamine-adenosine)
Components
  • RNA 1
  • RNA 2
  • RNA 3
KeywordsRNA / MTR1 / methyltransferase ribozyme / ribozyme
Function / homologyGUANINE / RNA / RNA (> 10)
Function and homology information
Biological speciessynthetic construct (others)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 3.26 Å
AuthorsMieczkowski, M. / Hoebartner, C.
Funding supportEuropean Union, 1items
OrganizationGrant numberCountry
European Research Council (ERC)European Union
CitationJournal: Nat.Chem.Biol. / Year: 2022
Title: Structure and mechanism of the methyltransferase ribozyme MTR1.
Authors: Scheitl, C.P.M. / Mieczkowski, M. / Schindelin, H. / Hobartner, C.
History
DepositionNov 9, 2021Deposition site: PDBE / Processing site: PDBE
Revision 1.0Mar 23, 2022Provider: repository / Type: Initial release
Revision 1.1Mar 30, 2022Group: Database references / Category: citation / citation_author
Item: _citation.pdbx_database_id_PubMed / _citation.title / _citation_author.name
Revision 1.2May 11, 2022Group: Database references / Category: citation
Item: _citation.journal_volume / _citation.page_first / _citation.page_last
Revision 1.3Jan 31, 2024Group: Data collection / Refinement description
Category: chem_comp_atom / chem_comp_bond / pdbx_initial_refinement_model

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: RNA 1
B: RNA 2
C: RNA 3
D: RNA 1
E: RNA 2
F: RNA 3
hetero molecules


Theoretical massNumber of molelcules
Total (without water)40,25611
Polymers39,8806
Non-polymers3755
Water1086
1
A: RNA 1
B: RNA 2
C: RNA 3
hetero molecules


Theoretical massNumber of molelcules
Total (without water)20,1406
Polymers19,9403
Non-polymers2003
Water362
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area4740 Å2
ΔGint-8 kcal/mol
Surface area10570 Å2
MethodPISA
2
D: RNA 1
E: RNA 2
F: RNA 3
hetero molecules


Theoretical massNumber of molelcules
Total (without water)20,1165
Polymers19,9403
Non-polymers1752
Water362
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area4690 Å2
ΔGint-8 kcal/mol
Surface area10720 Å2
MethodPISA
Unit cell
Length a, b, c (Å)117.861, 117.861, 83.275
Angle α, β, γ (deg.)90.00, 90.00, 90.00
Int Tables number91
Space group name H-MP4122

-
Components

-
RNA chain , 3 types, 6 molecules ADBECF

#1: RNA chain RNA 1


Mass: 4542.855 Da / Num. of mol.: 2 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#2: RNA chain RNA 2


Mass: 7641.636 Da / Num. of mol.: 2 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others)
#3: RNA chain RNA 3


Mass: 7755.703 Da / Num. of mol.: 2 / Source method: obtained synthetically / Details: GCUGGGACAACUAGACAUACAGUG / Source: (synth.) synthetic construct (others)

-
Non-polymers , 3 types, 11 molecules

#4: Chemical ChemComp-MG / MAGNESIUM ION


Mass: 24.305 Da / Num. of mol.: 3 / Source method: obtained synthetically / Formula: Mg
#5: Chemical ChemComp-GUN / GUANINE


Mass: 151.126 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: C5H5N5O
#6: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 6 / Source method: isolated from a natural source / Formula: H2O

-
Details

Has ligand of interestY

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.63 Å3/Da / Density % sol: 66.07 %
Crystal growTemperature: 293 K / Method: vapor diffusion
Details: 36-42% MPD, 50mM MES pH 6.4-6.7, 100mM NaCl, 100mM LiCl, 10mM MgCl2

-
Data collection

DiffractionMean temperature: 100 K / Serial crystal experiment: N
Diffraction sourceSource: SYNCHROTRON / Site: PETRA III, DESY / Beamline: P11 / Wavelength: 1.0332 Å
DetectorType: DECTRIS EIGER X 16M / Detector: PIXEL / Date: Mar 30, 2021
RadiationMonochromator: M / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1.0332 Å / Relative weight: 1
ReflectionResolution: 3.26→44.54 Å / Num. obs: 9584 / % possible obs: 99.71 % / Redundancy: 15.4 % / CC1/2: 0.995 / Rmerge(I) obs: 0.14 / Net I/σ(I): 11.9
Reflection shellResolution: 3.26→3.38 Å / Mean I/σ(I) obs: 0.6 / Num. unique obs: 937 / CC1/2: 0.236 / % possible all: 98.83

-
Processing

Software
NameVersionClassification
PHENIX(1.19.1_4122: ???)refinement
XDSdata reduction
Aimlessdata scaling
PHASERphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 7Q7X
Resolution: 3.26→44.54 Å / SU ML: 0.5 / Cross valid method: FREE R-VALUE / σ(F): 1.33 / Phase error: 34.66 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.2645 521 5.45 %
Rwork0.2102 --
obs0.2132 9568 99.78 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Refinement stepCycle: LAST / Resolution: 3.26→44.54 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms0 2640 24 6 2670
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.0012978
X-RAY DIFFRACTIONf_angle_d0.3034629
X-RAY DIFFRACTIONf_dihedral_angle_d13.0611470
X-RAY DIFFRACTIONf_chiral_restr0.011612
X-RAY DIFFRACTIONf_plane_restr0.001128
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
3.26-3.590.39271290.35242195X-RAY DIFFRACTION99
3.59-4.110.27961250.27012218X-RAY DIFFRACTION100
4.11-5.180.27881250.25882260X-RAY DIFFRACTION100
5.18-44.540.24231420.16932374X-RAY DIFFRACTION100
Refinement TLS params.Method: refined / Origin x: 20.4042 Å / Origin y: -41.2435 Å / Origin z: -8.9227 Å
111213212223313233
T0.8298 Å2-0.0257 Å2-0.0935 Å2-0.7939 Å20.043 Å2--1.1314 Å2
L3.3175 °2-1.5612 °21.0985 °2-4.5979 °2-1.5586 °2--2.878 °2
S0.3016 Å °0.1664 Å °-0.5917 Å °-0.3397 Å °-0.086 Å °0.5508 Å °-0.0483 Å °-0.0941 Å °-0.2191 Å °
Refinement TLS groupSelection details: all

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more