PDB-7otb: Ruthenium polypridyl complex bound to a unimolecular chair-form G...

ID or keywords:

Entry

Database: PDB / ID: 7otb

Title

Ruthenium polypridyl complex bound to a unimolecular chair-form G-quadruplex

Components

DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')

Keywords

DNA / Ruthenium / G-quadruplex / Chair / Telomeric

Function / homology

Chem-0K8 / : / : / DNA / DNA (> 10)

Function and homology information

Biological species

synthetic construct (others)

Method

X-RAY DIFFRACTION /

SYNCHROTRON /

SAD / Resolution: 1.6 Å

Authors

McQuaid, K.T. / Cardin, C.J. / Hall, J.P. / Paterson, N.G. / Baumgaertner, L.

Funding support

United Kingdom, 1items

Citation

Journal: J.Am.Chem.Soc. / Year: 2022
Title: Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.
Authors: McQuaid, K.T. / Takahashi, S. / Baumgaertner, L. / Cardin, D.J. / Paterson, N.G. / Hall, J.P. / Sugimoto, N. / Cardin, C.J.

History

Deposition	Jun 9, 2021	Deposition site: PDBE / Processing site: PDBE
Revision 1.0	Apr 6, 2022	Provider: repository / Type: Initial release
Revision 1.1	Apr 20, 2022	Group: Database references / Category: citation / citation_author Item: _citation.journal_volume / _citation.page_first ..._citation.journal_volume / _citation.page_first / _citation.page_last / _citation_author.identifier_ORCID
Revision 1.2	Jun 19, 2024	Group: Data collection / Category: chem_comp_atom / chem_comp_bond

Structure viewer	Molecule: MolmilJmol/JSmol

-
Download

PDBx/mmCIF format	7otb.cif.gz	57.7 KB	Display	PDBx/mmCIF format
PDB format	pdb7otb.ent.gz	43.4 KB	Display	PDB format
PDBx/mmJSON format	7otb.json.gz		Tree view	PDBx/mmJSON format
Others	Other downloads

-
Validation report

Summary document	7otb_validation.pdf.gz	769.8 KB	Display	wwPDB validaton report
Full document	7otb_full_validation.pdf.gz	771.2 KB	Display
Data in XML	7otb_validation.xml.gz	4.8 KB	Display
Data in CIF	7otb_validation.cif.gz	6.5 KB	Display
Arichive directory	https://data.pdbj.org/pub/pdb/validation_reports/ot/7otb ftp://data.pdbj.org/pub/pdb/validation_reports/ot/7otb	HTTPS FTP

-
Related structure data

Similar structure data	Similarity search - Function & homologyF&H Search Similarity search - HomologyF&H Search

-
Links

PDB pages	PDBj / wwPDB / NCBI
Related items in Molecule of the Month	#255 - Mar 2021 Cisplatin and DNA similarity (2) #67 - Jul 2005 TATA-Binding Protein similarity (1) #91 - Jul 2007 Thymine Dimers similarity (1) #168 - Dec 2013 DNA Helicase similarity (1) #253 - Jan 2021 Expressome similarity (1) #181 - Jan 2015 Cascade and CRISPR similarity (1) #122 - Feb 2010 Enhanceosome similarity (1) #172 - Apr 2014 RecA and Rad51 similarity (1) #84 - Dec 2006 Transposase similarity (1) #48 - Dec 2003 Catabolite Activator Protein similarity (1) #23 - Nov 2001 DNA similarity (2) #227 - Nov 2018 Telomerase similarity (1) #112 - Apr 2009 Oct and Sox Transcription Factors similarity (1) #180 - Dec 2014 TAL Effectors similarity (1) #150 - Jun 2012 Sliding Clamps similarity (1) #135 - Mar 2011 Integrase similarity (1) #40 - Apr 2003 RNA Polymerase similarity (1) #155 - Nov 2012 Vitamin D Receptor similarity (1) #87 - Mar 2007 Zinc Fingers similarity (1) #73 - Jan 2006 Topoisomerase similarity (1) #3 - Mar 2000 DNA Polymerase similarity (1) #139 - Jul 2011 DNA Methyltransferase similarity (1) #125 - May 2010 Parvoviruses similarity (1) #131 - Nov 2010 Inteins similarity (1) #8 - Aug 2000 Restriction Enzymes similarity (1) #7 - Jul 2000 Nucleosome similarity (1) #55 - Jul 2004 DNA Ligase similarity (1) #39 - Mar 2003 lac Repressor similarity (1) #45 - Sep 2003 Estrogen Receptor similarity (1) #190 - Oct 2015 Two-component Systems similarity (1) #33 - Sep 2002 HIV Reverse Transcriptase similarity (1) #31 - Jul 2002 p53 Tumor Suppressor similarity (1) #258 - Jun 2021 Glucocorticoid Receptor and Dexamethasone similarity (1) #257 - May 2021 Fetal Hemoglobin similarity (1) #119 - Nov 2009 Designed DNA Crystal similarity (1) #240 - Dec 2019 Hypoxia-Inducible Factors similarity (1) #160 - Apr 2013 Actinomycin similarity (1) #92 - Aug 2007 Anabolic Steroids similarity (1) #241 - Jan 2020 Twenty Years of Molecules similarity (1)

PDB pages

PDBj /

wwPDB /

NCBI

Related items in Molecule of the Month

#255 - Mar 2021
Cisplatin and DNA
similarity (2)
#67 - Jul 2005
TATA-Binding Protein
similarity (1)
#91 - Jul 2007
Thymine Dimers
similarity (1)
#168 - Dec 2013
DNA Helicase
similarity (1)
#253 - Jan 2021
Expressome
similarity (1)
#181 - Jan 2015
Cascade and CRISPR
similarity (1)
#122 - Feb 2010
Enhanceosome
similarity (1)
#172 - Apr 2014
RecA and Rad51
similarity (1)
#84 - Dec 2006
Transposase
similarity (1)
#48 - Dec 2003
Catabolite Activator Protein
similarity (1)
#23 - Nov 2001
DNA
similarity (2)
#227 - Nov 2018
Telomerase
similarity (1)
#112 - Apr 2009
Oct and Sox Transcription Factors
similarity (1)
#180 - Dec 2014
TAL Effectors
similarity (1)
#150 - Jun 2012
Sliding Clamps
similarity (1)
#135 - Mar 2011
Integrase
similarity (1)
#40 - Apr 2003
RNA Polymerase
similarity (1)
#155 - Nov 2012
Vitamin D Receptor
similarity (1)
#87 - Mar 2007
Zinc Fingers
similarity (1)
#73 - Jan 2006
Topoisomerase
similarity (1)
#3 - Mar 2000
DNA Polymerase
similarity (1)
#139 - Jul 2011
DNA Methyltransferase
similarity (1)
#125 - May 2010
Parvoviruses
similarity (1)
#131 - Nov 2010
Inteins
similarity (1)
#8 - Aug 2000
Restriction Enzymes
similarity (1)
#7 - Jul 2000
Nucleosome
similarity (1)
#55 - Jul 2004
DNA Ligase
similarity (1)
#39 - Mar 2003
lac Repressor
similarity (1)
#45 - Sep 2003
Estrogen Receptor
similarity (1)
#190 - Oct 2015
Two-component Systems
similarity (1)
#33 - Sep 2002
HIV Reverse Transcriptase
similarity (1)
#31 - Jul 2002
p53 Tumor Suppressor
similarity (1)
#258 - Jun 2021
Glucocorticoid Receptor and Dexamethasone
similarity (1)
#257 - May 2021
Fetal Hemoglobin
similarity (1)
#119 - Nov 2009
Designed DNA Crystal
similarity (1)
#240 - Dec 2019
Hypoxia-Inducible Factors
similarity (1)
#160 - Apr 2013
Actinomycin
similarity (1)
#92 - Aug 2007
Anabolic Steroids
similarity (1)
#241 - Jan 2020
Twenty Years of Molecules
similarity (1)

Deposited unit

A: DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')

hetero molecules

7.83 kDa, 1 polymers
Search similar-shape structures of this assembly by Omokage search (details)

1

Idetical with deposited unit
defined by author&software

Unit cell

Length a, b, c (Å)	29.680, 29.680, 113.980
Angle α, β, γ (deg.)	90.000, 90.000, 120.000
Int Tables number	154
Space group name H-M	P3₂21

Components on special symmetry positions

ID	Model	Components
1	1	A-296- HOH
2	1	A-299- HOH
3	1	A-300- HOH

#1: DNA chain	DNA (5'-D(GPGPGPTPTPAPGPGPGPTPTPAPGPGPGPTPTPTPGPGPG)-3') Mass: 6661.276 Da / Num. of mol.: 1 / Source method: obtained synthetically Details: G-quadruplex forming sequence from the telomeric region of human DNA. Source*: (synth.) synthetic construct (others)
#2: Chemical	ChemComp-K / POTASSIUM ION Mass: 39.098 Da / Num. of mol.: 4 / Source method: obtained synthetically / Formula: K
#3: Chemical	ChemComp-BA / BARIUM ION Mass: 137.327 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: Ba
#4: Chemical	ChemComp-0K8 / Ruthenium bis-(phenanthroline) 12,17-dihydro-naphthodipyridophenazine-12,17-dione / Ruthenium polypridyl complex Mass: 873.880 Da / Num. of mol.: 1 / Source method: obtained synthetically / Formula: C₅₀H₂₈N₈O₂Ru / Feature type: SUBJECT OF INVESTIGATION
#5: Water	ChemComp-HOH / water Mass: 18.015 Da / Num. of mol.: 111 / Source method: isolated from a natural source / Formula: H₂O
Has ligand of interest	Y

-
Experiment

Experiment	Method: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

Crystal	Density Matthews: 2.2 Å³/Da / Density % sol: 38 %
Crystal grow	Temperature: 277 K / Method: vapor diffusion, sitting drop / pH: 7 Details: Annealing: 200 uM L-[Ru(phen)2(Aqphen)]2+, 200 uM GGGTTAGGGTTAGGGTTTGGG, and 10 mM KCl. Crystallisation: 100 uM L-[Ru(phen)2(Aqphen)]2+, 100 uM GGGTTAGGGTTAGGGTTTGGG, 5 mM KCl, 40 mM NaCl, ...Details: Annealing: 200 uM L-[Ru(phen)2(Aqphen)]2+, 200 uM GGGTTAGGGTTAGGGTTTGGG, and 10 mM KCl. Crystallisation: 100 uM L-[Ru(phen)2(Aqphen)]2+, 100 uM GGGTTAGGGTTAGGGTTTGGG, 5 mM KCl, 40 mM NaCl, 20 mM Na Cacodylate pH 7.0, 20% v/v MPD, 6 mM spermine hydrochloride, and 10 mM BaCl2. Temp details: Cold Room

Crystal

Density Matthews: 2.2 Å³/Da / Density % sol: 38 %

Crystal grow

Temperature: 277 K / Method: vapor diffusion, sitting drop / pH: 7
Details: Annealing: 200 uM L-[Ru(phen)2(Aqphen)]2+, 200 uM GGGTTAGGGTTAGGGTTTGGG, and 10 mM KCl. Crystallisation: 100 uM L-[Ru(phen)2(Aqphen)]2+, 100 uM GGGTTAGGGTTAGGGTTTGGG, 5 mM KCl, 40 mM NaCl, ...
Temp details: Cold Room

-
Data collection

Diffraction

Mean temperature: 100 K / Serial crystal experiment: N

Diffraction source

Source:

SYNCHROTRON / Site:

Diamond

/ Beamline: I03 / Wavelength: 0.5604, 1.7712

Detector

Type: DECTRIS EIGER2 XE 16M / Detector: PIXEL / Date: May 17, 2021

Radiation

Monochromator: M / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray

Radiation wavelength

ID	Wavelength (Å)	Relative weight
1	0.5604	1
2	1.7712	1

Reflection

Resolution: 1.6→21.29 Å / Num. obs: 140815 / % possible obs: 99.7 % / Redundancy: 17 % / B_iso Wilson estimate: 22.39 Å² / CC_1/2: 0.999 / CC star: 1 / R_merge(I) obs: 0.1006 / R_pim(I) all: 0.02564 / R_rim(I) all: 0.1039 / Net I/σ(I): 14.35

Reflection shell

Resolution: 1.6→1.657 Å / Redundancy: 11.8 % / R_merge(I) obs: 0.5729 / Mean I/σ(I) obs: 2.39 / Num. unique obs: 797 / CC_1/2: 0.932 / CC star: 0.982 / R_pim(I) all: 0.171 / R_rim(I) all: 0.5988 / % possible all: 98.15

-
Processing

Software

Name	Version	Classification
PHENIX	1.19.2_4158	refinement
PDB_EXTRACT	3.27	data extraction
xia2		data reduction
XDS		data reduction
xia2		data scaling
XSCALE		data scaling
SHELXDE		phasing
Coot		model building

Refinement

Method to determine structure:

SAD / Resolution: 1.6→21.29 Å / SU ML: 0.17 / Cross valid method: THROUGHOUT / σ(F): 1.35 / Phase error: 24.93 / Stereochemistry target values: ML

	R_factor	Num. reflection	% reflection
R_free	0.181	1471	9.95 %
R_work	0.1648	13316	-
obs	0.1663	14787	99.82 %

Solvent computation

Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL

Displacement parameters

B_iso max: 65.08 Å² / B_iso mean: 30.1717 Å² / B_iso min: 17.16 Å²

Refinement step

Cycle: final / Resolution: 1.6→21.29 Å

	Protein	Nucleic acid	Ligand	Solvent	Total
Num. atoms	0	443	94	113	650
B_iso mean	-	-	24.52	38.47	-
Num. residues	-	-	-	-	21

LS refinement shell

Refine-ID: X-RAY DIFFRACTION / R_factor R_free error: 0 / Total num. of bins used: 11

Resolution (Å)	R_factor R_free	Num. reflection R_free	R_factor R_work	Num. reflection R_work	Num. reflection all	% reflection obs (%)
1.6-1.65	0.2544	134	0.2653	1194	1328	99
1.65-1.71	0.263	138	0.2305	1194	1332	100
1.71-1.78	0.2406	138	0.2071	1216	1354	100
1.78-1.86	0.2852	139	0.2277	1221	1360	100
1.86-1.96	0.2544	128	0.2131	1219	1347	100
1.96-2.08	0.2674	119	0.2059	1200	1319	100
2.08-2.24	0.2264	132	0.2039	1217	1349	100
2.24-2.47	0.191	144	0.1822	1240	1384	100
2.47-2.82	0.1834	123	0.1708	1196	1319	100
2.82-3.55	0.1319	135	0.1365	1203	1338	100
3.56-21.29	0.1437	141	0.1249	1216	1357	100

Refinement TLS params.

Method: refined / Refine-ID: X-RAY DIFFRACTION

ID	L11 (°²)	L12 (°²)	L13 (°²)	L22 (°²)	L23 (°²)	L33 (°²)	S11 (Å °)	S12 (Å °)	S13 (Å °)	S21 (Å °)	S22 (Å °)	S23 (Å °)	S31 (Å °)	S32 (Å °)	S33 (Å °)	T11 (Å²)	T12 (Å²)	T13 (Å²)	T22 (Å²)	T23 (Å²)	T33 (Å²)	Origin x (Å)	Origin y (Å)	Origin z (Å)
1	4.4546	-5.8835	2.7627	9.4666	-6.1814	5.7125	0.0214	-0.4183	1.0928	-0.4362	0.4947	-0.4016	-0.3738	-0.9766	-0.6912	0.2351	0.0152	0.0222	0.2346	0.0063	0.3357	-5.0284	20.6576	44.8204
2	1.9997	-7.3989	3.2898	5.8954	-4.4411	7.3702	-0.4382	-0.2508	0.2467	0.3143	0.5635	0.0936	-0.8641	-0.3365	-0.2085	0.372	0.0423	0.032	0.3567	-0.0347	0.3214	-3.8906	21.8372	48.8787
3	6.0859	-3.6872	-5.1532	8.5655	4.9657	6.9214	0.1656	-0.4267	-0.2504	-0.1088	-0.0277	-0.1397	-0.1447	0.2878	-0.171	0.1621	-0.0183	-0.0183	0.209	-0.0133	0.2192	-0.1363	11.0065	38.5556
4	6.0537	-2.0987	-5.7461	6.5529	5.6008	7.9285	0.6631	-0.0232	0.7265	0.0326	-0.3073	0.7765	-0.8279	-0.5308	-0.3287	0.4161	0.001	0.0606	0.2804	-0.0294	0.2679	-1.6421	20.6999	53.2514
5	1.7493	1.9321	2.6495	2.1391	2.9343	4.0252	-0.7584	0.5981	-0.2877	-0.7561	1.2942	-0.5542	-0.0842	0.5759	-0.5012	0.5231	-0.0617	0.1098	0.462	-0.1176	0.2849	0.4094	23.8329	60.098
6	3.1277	0.3873	-3.2517	5.9433	-3.3523	4.8566	0.4348	-1.2254	1.2032	1.1303	0.3676	0.2237	-1.6814	0.8412	-0.6691	0.476	-0.0097	0.0429	0.377	-0.099	0.2693	2.8218	19.4226	55.5578
7	6.8874	7.0061	6.8737	7.329	7.2349	7.2494	0.336	-0.5054	0.5073	1.7565	0.2419	-0.7142	0.3493	1.6132	-0.6356	0.5845	-0.0115	-0.1557	0.4297	-0.0867	0.4273	6.1145	15.2275	55.1481
8	6.4545	-6.5086	6.3467	7.0034	-6.6015	6.5441	-0.2429	-0.2941	-0.2287	0.5869	0.5078	-0.4483	0.2915	0.385	-0.2957	0.3247	0.013	-0.0429	0.2046	-0.0171	0.231	4.5924	11.3262	51.0559
9	6.6289	1.7028	-0.8748	6.1186	-6.802	8.7703	0.2027	-0.2688	0.0227	0.33	-0.3669	-0.6005	-0.0543	0.1411	0.0721	0.2792	0.004	0.0036	0.2423	-0.0235	0.2055	-0.3819	9.9453	50.744
10	9.3358	7.2882	-7.577	2.0002	-9.1424	8.8634	0.255	-0.5697	-0.1043	0.3125	-0.283	-0.4833	-0.1936	0.3215	-0.0343	0.3008	-0.0261	0.0159	0.22	-0.0212	0.2013	-5.2127	10.8381	49.975
11	8.9353	6.7713	1.0433	5.3591	0.4894	4.2938	0.5542	-0.3509	-0.2536	0.4924	-0.189	0.7225	-0.5337	-0.1257	-0.3179	0.2394	0.04	0.0317	0.301	-0.0664	0.3045	-10.2376	12.3705	45.9085
12	5.9106	-5.8211	-0.1078	5.9793	-1.293	9.9232	-0.2391	0.8582	-0.8919	0.2859	-0.2639	1.0129	-0.1985	-0.1282	0.4939	0.2504	-0.0155	0.0339	0.2568	-0.0312	0.3266	-10.6133	8.6642	43.0546
13	4.6093	3.8167	-5.496	5.5436	-2.6073	8.1686	-0.1472	-0.7726	-0.4743	-0.0845	0.0981	0.2557	1.0419	-0.4532	-0.08	0.2448	0.0267	0.0003	0.3126	0.0114	0.2951	-5.4465	8.8892	43.1465
14	9.9517	6.4137	-3.8754	4.6322	-2.1159	2.6964	-0.422	-0.0826	-0.18	-0.1594	0.0385	0.0172	-0.2812	-0.3249	0.4129	0.2664	0.034	-0.0332	0.2039	-0.0154	0.2248	0.6773	8.5329	43.7876
15	2.0005	-1.2366	-6.2018	3.2188	0.8064	4.4464	0.3023	-0.6165	-0.9006	0.0558	-0.1887	-0.0489	-0.3243	0.2172	-0.1156	0.2515	-0.0232	0.0002	0.2894	-0.035	0.2947	5.2635	10.6676	44.314
16	7.0301	-2.7099	-4.4995	6.539	4.7068	4.6846	-0.0187	0.5924	-0.5812	-0.1403	-0.2021	-0.1062	-0.1612	0.0748	0.1843	0.1934	-0.0229	0.0035	0.2992	0.002	0.2764	8.5607	14.4449	44.6611
17	6.941	2.0061	-6.3999	2.311	-1.7889	6.022	0.6043	-0.778	-0.5797	0.1563	-0.3889	-0.5004	-0.5185	0.6104	-0.1232	0.2657	-0.0035	-0.0134	0.2499	0.0153	0.3356	9.9629	19.2558	44.1435
18	7.2007	5.8354	3.4212	5.3168	3.238	2.8289	-0.6433	0.5203	-2.6827	-1.73	0.1217	1.4847	1.1488	-0.8745	0.4935	0.5124	-0.0831	-0.011	0.3374	-0.0313	0.5801	8.4118	23.9849	41.4768
19	8.1918	-6.8235	4.4222	8.4969	-2.0883	4.9832	-0.2786	0.5396	0.2189	0.9035	-0.2976	-0.5069	-0.7051	0.4183	0.5031	0.3749	-0.0077	-0.0178	0.2957	0.0033	0.3126	6.9081	23.1993	48.1575
20	6.1687	-1.0141	1.4117	4.3293	-5.7657	7.681	-0.2644	-0.4605	0.3348	0.9657	0.0183	-0.0941	-0.4914	-0.1592	0.1294	0.2883	-0.0255	0.0024	0.2541	-0.0147	0.2677	2.1055	23.7968	46.3693
21	5.0851	-5.5922	4.8515	6.4366	-5.8968	8.9464	-0.3742	0.1577	0.5352	-0.3441	0.5587	0.489	-0.7727	-0.1138	-0.0157	0.2583	-0.032	0.0191	0.2404	-0.0174	0.2767	0.729	21.9238	41.5414
22	2.271	0.0947	-1.3621	2.9747	-2.5768	3.0496	-0.0567	0.1969	0.3514	-1.1714	-0.0478	0.1867	-1.3423	-0.1649	0.2234	0.4228	-0.0033	-0.033	0.3348	-0.0286	0.2582	-0.0214	18.7525	37.8074

Refinement TLS group

ID	Refine-ID	Refine TLS-ID	Selection details	Auth asym-ID	Auth seq-ID
1	X-RAY DIFFRACTION	1	{ A\|1 }	A	1
2	X-RAY DIFFRACTION	2	{ A\|2 }	A	2
3	X-RAY DIFFRACTION	3	{ A\|106 }	A	106
4	X-RAY DIFFRACTION	4	{ A\|3 }	A	3
5	X-RAY DIFFRACTION	5	{ A\|4 }	A	4
6	X-RAY DIFFRACTION	6	{ A\|5 }	A	5
7	X-RAY DIFFRACTION	7	chain 'A' (resid 6)	A	6
8	X-RAY DIFFRACTION	8	chain 'A' (resid 7)	A	7
9	X-RAY DIFFRACTION	9	chain 'A' (resid 8)	A	8
10	X-RAY DIFFRACTION	10	chain 'A' (resid 9)	A	9
11	X-RAY DIFFRACTION	11	chain 'A' (resid 10)	A	10
12	X-RAY DIFFRACTION	12	chain 'A' (resid 11)	A	11
13	X-RAY DIFFRACTION	13	chain 'A' (resid 12)	A	12
14	X-RAY DIFFRACTION	14	chain 'A' (resid 13)	A	13
15	X-RAY DIFFRACTION	15	chain 'A' (resid 14)	A	14
16	X-RAY DIFFRACTION	16	chain 'A' (resid 15)	A	15
17	X-RAY DIFFRACTION	17	chain 'A' (resid 16)	A	16
18	X-RAY DIFFRACTION	18	chain 'A' (resid 17)	A	17
19	X-RAY DIFFRACTION	19	chain 'A' (resid 18)	A	18
20	X-RAY DIFFRACTION	20	chain 'A' (resid 19)	A	19
21	X-RAY DIFFRACTION	21	chain 'A' (resid 20)	A	20
22	X-RAY DIFFRACTION	22	chain 'A' (resid 21)	A	21

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

Version 3 of the EMDB header file is now the official format.
The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlvh1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi

Thousand views of thousand structures

Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

-
Movie

-
Structure viewers

+
Viewer log

-
This page

-
This web site

-
Options

+
Open data

-
Basic information

-
Structure visualization

-
Downloads & links

-
Download

-
Validation report

-
Related structure data

-
Links

-
Assembly

-
Components

-
Experimental details

-
Experiment

-
Sample preparation

-
Data collection

-
Processing

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

-
Aug 12, 2020. Covid-19 info

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi

-Movie

-Structure viewers

+Viewer log

-This page

-This web site

-Options

+Open data

-Basic information

-Structure visualization

-Downloads & links

-Download

-Validation report

-Related structure data

-Links

-Assembly

-Components

-Experimental details

-Experiment

-Sample preparation

-Data collection

-Processing

+About Yorodumi

-News

-Feb 9, 2022. New format data for meta-information of EMDB entries

-Aug 12, 2020. Covid-19 info

+Mar 5, 2020. Novel coronavirus structure data

+Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+Jul 12, 2017. Major update of PDB

-Yorodumi

-
Movie

-
Structure viewers

+
Viewer log

-
This page

-
This web site

-
Options

+
Open data

-
Basic information

-
Structure visualization

-
Downloads & links

-
Download

-
Validation report

-
Related structure data

-
Links

-
Assembly

-
Components

-
Experimental details

-
Experiment

-
Sample preparation

-
Data collection

-
Processing

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

-
Aug 12, 2020. Covid-19 info

+
Mar 5, 2020. Novel coronavirus structure data

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

+
Jul 12, 2017. Major update of PDB

-
Yorodumi