[English] 日本語
Yorodumi
- PDB-2r1j: Crystal Structure of the P22 c2 Repressor protein in complex with... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 2r1j
TitleCrystal Structure of the P22 c2 Repressor protein in complex with the synthetic operator 9T
Components
  • 5'-D(*DCP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DA)-3'
  • 5'-D(*DTP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DG)-3'
  • Repressor protein C2
KeywordsTRANSCRIPTION/DNA / Protein-DNA complex / Helix-turn-helix / DNA-binding / Repressor / Transcription / Transcription regulation / TRANSCRIPTION-DNA COMPLEX
Function / homology
Function and homology information


DNA-templated transcription / DNA binding
Similarity search - Function
: / LexA-like / Peptidase S24/S26A/S26B/S26C / Peptidase S24-like / LexA/Signal peptidase-like superfamily / Helix-turn-helix / lambda repressor-like DNA-binding domains / Helix-turn-helix XRE-family like proteins / Cro/C1-type HTH domain profile. / Cro/C1-type helix-turn-helix domain ...: / LexA-like / Peptidase S24/S26A/S26B/S26C / Peptidase S24-like / LexA/Signal peptidase-like superfamily / Helix-turn-helix / lambda repressor-like DNA-binding domains / Helix-turn-helix XRE-family like proteins / Cro/C1-type HTH domain profile. / Cro/C1-type helix-turn-helix domain / 434 Repressor (Amino-terminal Domain) / Lambda repressor-like, DNA-binding domain superfamily / Orthogonal Bundle / Mainly Alpha
Similarity search - Domain/homology
DNA / DNA (> 10) / Repressor protein C2
Similarity search - Component
Biological speciesEnterobacteria phage P22 (virus)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 1.53 Å
AuthorsWilliams, L.D. / Koudelka, G.B. / Watkins, D. / Hsiao, C. / Woods, K.
CitationJournal: Biochemistry / Year: 2008
Title: P22 c2 repressor-operator complex: mechanisms of direct and indirect readout
Authors: Watkins, D. / Hsiao, C. / Woods, K.K. / Koudelka, G.B. / Williams, L.D.
History
DepositionAug 22, 2007Deposition site: RCSB / Processing site: RCSB
Revision 1.0Apr 29, 2008Provider: repository / Type: Initial release
Revision 1.1Jul 13, 2011Group: Version format compliance
Revision 1.2Oct 25, 2017Group: Refinement description / Category: software
Revision 1.3Feb 21, 2024Group: Data collection / Database references / Category: chem_comp_atom / chem_comp_bond / database_2
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
B: 5'-D(*DCP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DA)-3'
A: 5'-D(*DTP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DG)-3'
L: Repressor protein C2
R: Repressor protein C2


Theoretical massNumber of molelcules
Total (without water)27,5134
Polymers27,5134
Non-polymers00
Water5,963331
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area5340 Å2
ΔGint-39.4 kcal/mol
Surface area12280 Å2
MethodPISA
Unit cell
Length a, b, c (Å)64.105, 64.105, 101.685
Angle α, β, γ (deg.)90.000, 90.000, 90.000
Int Tables number78
Space group name H-MP43

-
Components

#1: DNA chain 5'-D(*DCP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DA)-3'


Mass: 6115.016 Da / Num. of mol.: 1 / Source method: obtained synthetically
#2: DNA chain 5'-D(*DTP*DAP*DTP*DTP*DTP*DAP*DAP*DGP*DAP*DTP*DAP*DTP*DCP*DTP*DTP*DAP*DAP*DAP*DTP*DG)-3'


Mass: 6146.026 Da / Num. of mol.: 1 / Source method: obtained synthetically
#3: Protein Repressor protein C2


Mass: 7625.878 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Enterobacteria phage P22 (virus) / Genus: P22-like viruses / Gene: c2 / Plasmid: pUC18 / Production host: Escherichia coli (E. coli) / Strain (production host): XA90 / References: UniProt: P69202
#4: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 331 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.8 Å3/Da / Density % sol: 67.61 %
Crystal growTemperature: 277 K / Method: vapor diffusion, hanging drop / pH: 7.8
Details: The initial crystallization solution contained 0.42 mM P22R NTD, 0.42 mM duplex d(5 TATTTAAGATATCTTAAATG3 ) -d(5 CATTTAAGATATCTTAAATA3 ), 45 mM Tris.HCl (pH 7.8), 19 mM NaCl, 1.9 mM ...Details: The initial crystallization solution contained 0.42 mM P22R NTD, 0.42 mM duplex d(5 TATTTAAGATATCTTAAATG3 ) -d(5 CATTTAAGATATCTTAAATA3 ), 45 mM Tris.HCl (pH 7.8), 19 mM NaCl, 1.9 mM glycerol, 11% PEG 400, 4.5 mM LiCl, 2.3mM MgCl2 and 0.91% MPD in a volume of 5.3 ul. The crystallization solution was equilibrated against a reservoir of 100 mM Tris.HCl (pH 7.8), 25% PEG 400, 10 mM LiCl, 5 mM MgCl2 and 2% MPD, VAPOR DIFFUSION, HANGING DROP, temperature 277K
Components of the solutions
IDNameCrystal-IDSol-ID
1Tris.HCl11
2NaCl11
3glycerol11
4PEG 40011
5LiCl11
6MgCl211
7MPD11
8Tris.HCl12
9PEG 40012
10LiCl12
11MgCl212
12MPD12

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 22-ID / Wavelength: 0.99997 / Wavelength: 1 Å
DetectorType: MARMOSAIC 300 mm CCD / Detector: CCD
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelength
IDWavelength (Å)Relative weight
10.999971
211
ReflectionResolution: 1.53→35 Å / Num. all: 60878 / Num. obs: 60878 / % possible obs: 99.4 % / Observed criterion σ(I): 0 / Redundancy: 5.8 % / Rsym value: 0.069 / Net I/σ(I): 47.1
Reflection shellResolution: 1.53→1.57 Å / Redundancy: 4.7 % / Rmerge(I) obs: 0.659 / Mean I/σ(I) obs: 2.12 / Num. unique all: 4319 / Rsym value: 0.659 / % possible all: 99.3

-
Phasing

PhasingMethod: molecular replacement
Phasing MRCor.coef. Fo:Fc: 0.847 / Packing: 0.311
Highest resolutionLowest resolutionMethodReflection percentσ(F)
Translation3 Å15 Ågeneral98.4 0

-
Processing

Software
NameVersionClassificationNB
DENZOdata reduction
SCALEPACKdata scaling
CNSrefinement
PDB_EXTRACT3data extraction
HKL-2000data collection
CNSphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT / Resolution: 1.53→35 Å / FOM work R set: 0.825 / σ(F): 0
RfactorNum. reflection% reflection
Rfree0.225 6068 9.8 %
Rwork0.204 --
obs-59833 96.9 %
Solvent computationBsol: 58.05 Å2
Displacement parametersBiso mean: 31.053 Å2
Refinement stepCycle: LAST / Resolution: 1.53→35 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms1030 814 0 331 2175
Refine LS restraints
Refine-IDTypeDev idealDev ideal target
X-RAY DIFFRACTIONc_bond_d0.01
X-RAY DIFFRACTIONc_angle_deg1.334
X-RAY DIFFRACTIONc_mcbond_it1.2781.5
X-RAY DIFFRACTIONc_scbond_it1.9832
X-RAY DIFFRACTIONc_mcangle_it2.0062
X-RAY DIFFRACTIONc_scangle_it3.052.5
LS refinement shellResolution: 1.53→1.58 Å
RfactorNum. reflection% reflection
Rfree0.34 535 -
Rwork0.356 --
obs-5325 86.7 %
Xplor file
Refine-IDSerial noParam fileTopol file
X-RAY DIFFRACTION1protein_rep.paramprotein.top
X-RAY DIFFRACTION2dna-rna_rep_tinoush.paramdna-rna_tinoush.top
X-RAY DIFFRACTION3water_rep.paramwater.top
X-RAY DIFFRACTION4ion.paramion.top

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more