+
Open data
-
Basic information
Entry | Database: PDB / ID: 1k1s | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal Structure of DinB from Sulfolobus solfataricus | ||||||
![]() | DBH protein | ||||||
![]() | TRANSCRIPTION / mixed a/b structure / 4-stranded antiparallel b-sheet | ||||||
Function / homology | ![]() error-prone translesion synthesis / DNA-templated DNA replication / damaged DNA binding / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / magnesium ion binding / cytoplasm Similarity search - Function | ||||||
Biological species | ![]() ![]() | ||||||
Method | ![]() ![]() ![]() | ||||||
![]() | Silvian, L.F. / Toth, E.A. / Pham, P. / Goodman, M.F. / Ellenberger, T. | ||||||
![]() | ![]() Title: Crystal structure of a DinB family error-prone DNA polymerase from Sulfolobus solfataricus. Authors: Silvian, L.F. / Toth, E.A. / Pham, P. / Goodman, M.F. / Ellenberger, T. | ||||||
History |
|
-
Structure visualization
Structure viewer | Molecule: ![]() ![]() |
---|
-
Downloads & links
-
Download
PDBx/mmCIF format | ![]() | 79.2 KB | Display | ![]() |
---|---|---|---|---|
PDB format | ![]() | 59.3 KB | Display | ![]() |
PDBx/mmJSON format | ![]() | Tree view | ![]() | |
Others | ![]() |
-Validation report
Summary document | ![]() | 429.3 KB | Display | ![]() |
---|---|---|---|---|
Full document | ![]() | 443.7 KB | Display | |
Data in XML | ![]() | 15.8 KB | Display | |
Data in CIF | ![]() | 20.7 KB | Display | |
Arichive directory | ![]() ![]() | HTTPS FTP |
-Related structure data
Related structure data | ![]() 1k1qC ![]() 1im4S C: citing same article ( S: Starting model for refinement |
---|---|
Similar structure data |
-
Links
-
Assembly
Deposited unit | ![]()
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-
Components
#1: Protein | Mass: 40029.773 Da / Num. of mol.: 1 / Mutation: C31S Source method: isolated from a genetically manipulated source Source: (gene. exp.) ![]() ![]() ![]() ![]() |
---|---|
#2: Water | ChemComp-HOH / |
-Experimental details
-Experiment
Experiment | Method: ![]() |
---|
-
Sample preparation
Crystal | Density Matthews: 2.88 Å3/Da / Density % sol: 57.32 % | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Crystal grow | Temperature: 298 K / Method: vapor diffusion, hanging drop / pH: 6.2 Details: Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, ...Details: Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Crystal grow | *PLUS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Components of the solutions | *PLUS
|
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: ![]() ![]() ![]() |
Detector | Type: BRANDEIS - B4 / Detector: CCD / Date: Jul 26, 2001 / Details: Wiggler |
Radiation | Monochromator: Si 111 channel / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 1.1 Å / Relative weight: 1 |
Reflection | Resolution: 2.8→37 Å / Num. all: 11002 / Num. obs: 11002 / % possible obs: 99.9 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 0 / Redundancy: 7.1 % / Rmerge(I) obs: 0.08 / Net I/σ(I): 20.1 |
Reflection shell | Resolution: 2.8→2.9 Å / Redundancy: 7.1 % / Rmerge(I) obs: 0.501 / Mean I/σ(I) obs: 4.7 / Num. unique all: 1126 / % possible all: 100 |
Reflection | *PLUS Rmerge(I) obs: 0.08 |
Reflection shell | *PLUS % possible obs: 100 % |
-
Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: ![]() Starting model: PDB entry 1IM4 Resolution: 2.8→37 Å / Rfactor Rfree error: 0.008 / Data cutoff high absF: 617472.89 / Data cutoff low absF: 0 / Isotropic thermal model: RESTRAINED / Cross valid method: THROUGHOUT / σ(F): 0 / Stereochemistry target values: Engh & Huber
| ||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Solvent model: FLAT MODEL / Bsol: 55.8395 Å2 / ksol: 0.380645 e/Å3 | ||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso mean: 72.9 Å2
| ||||||||||||||||||||||||||||||||||||||||||||
Refine analyze |
| ||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 2.8→37 Å
| ||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| ||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Resolution: 2.8→2.98 Å / Rfactor Rfree error: 0.032 / Total num. of bins used: 6
| ||||||||||||||||||||||||||||||||||||||||||||
Xplor file |
| ||||||||||||||||||||||||||||||||||||||||||||
Software | *PLUS Name: CNS / Version: 1 / Classification: refinement | ||||||||||||||||||||||||||||||||||||||||||||
Refinement | *PLUS σ(F): 0 / % reflection Rfree: 10.5 % / Rfactor obs: 0.237 | ||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | *PLUS | ||||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | *PLUS Biso mean: 72.9 Å2 | ||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints | *PLUS
| ||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | *PLUS Rfactor Rfree: 0.426 / % reflection Rfree: 10.2 % / Rfactor Rwork: 0.338 |