[English] 日本語
Yorodumi
- PDB-1k1s: Crystal Structure of DinB from Sulfolobus solfataricus -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 1k1s
TitleCrystal Structure of DinB from Sulfolobus solfataricus
ComponentsDBH protein
KeywordsTRANSCRIPTION / mixed a/b structure / 4-stranded antiparallel b-sheet
Function / homology
Function and homology information


SOS response / error-prone translesion synthesis / DNA-templated DNA replication / damaged DNA binding / DNA-directed DNA polymerase / DNA-directed DNA polymerase activity / magnesium ion binding / cytosol
Similarity search - Function
DNA polymerase type-Y, HhH motif / IMS family HHH motif / DNA polymerase IV / DNA polymerase, Y-family, little finger domain / MutS, DNA mismatch repair protein, domain I - #60 / MutS, DNA mismatch repair protein, domain I / UmuC domain / DNA polymerase, Y-family, little finger domain superfamily / impB/mucB/samB family / UmuC domain profile. ...DNA polymerase type-Y, HhH motif / IMS family HHH motif / DNA polymerase IV / DNA polymerase, Y-family, little finger domain / MutS, DNA mismatch repair protein, domain I - #60 / MutS, DNA mismatch repair protein, domain I / UmuC domain / DNA polymerase, Y-family, little finger domain superfamily / impB/mucB/samB family / UmuC domain profile. / Reverse transcriptase/Diguanylate cyclase domain / Dna Ligase; domain 1 / 5' to 3' exonuclease, C-terminal subdomain / DNA polymerase; domain 1 / Reverse transcriptase/Diguanylate cyclase domain / Alpha-Beta Plaits / DNA/RNA polymerase superfamily / 2-Layer Sandwich / Orthogonal Bundle / 3-Layer(aba) Sandwich / Mainly Alpha / Alpha Beta
Similarity search - Domain/homology
Biological speciesSulfolobus solfataricus (archaea)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 2.8 Å
AuthorsSilvian, L.F. / Toth, E.A. / Pham, P. / Goodman, M.F. / Ellenberger, T.
CitationJournal: Nat.Struct.Biol. / Year: 2001
Title: Crystal structure of a DinB family error-prone DNA polymerase from Sulfolobus solfataricus.
Authors: Silvian, L.F. / Toth, E.A. / Pham, P. / Goodman, M.F. / Ellenberger, T.
History
DepositionSep 25, 2001Deposition site: RCSB / Processing site: RCSB
Revision 1.0Oct 31, 2001Provider: repository / Type: Initial release
Revision 1.1Apr 27, 2008Group: Version format compliance
Revision 1.2Jul 13, 2011Group: Version format compliance
Revision 1.3Oct 27, 2021Group: Database references / Category: database_2 / struct_ref_seq_dif
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession / _struct_ref_seq_dif.details
Revision 1.4Aug 16, 2023Group: Data collection / Refinement description
Category: chem_comp_atom / chem_comp_bond / pdbx_initial_refinement_model

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: DBH protein


Theoretical massNumber of molelcules
Total (without water)40,0301
Polymers40,0301
Non-polymers00
Water55831
1


  • Idetical with deposited unit
  • defined by author
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Unit cell
Length a, b, c (Å)113.040, 113.040, 62.580
Angle α, β, γ (deg.)90.00, 90.00, 120.00
Int Tables number171
Space group name H-MP62

-
Components

#1: Protein DBH protein


Mass: 40029.773 Da / Num. of mol.: 1 / Mutation: C31S
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Sulfolobus solfataricus (archaea) / Gene: DINB / Plasmid: pet17 / Production host: Escherichia coli (E. coli) / Strain (production host): BL21 (RIL) / References: UniProt: P96022
#2: Water ChemComp-HOH / water


Mass: 18.015 Da / Num. of mol.: 31 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 2.88 Å3/Da / Density % sol: 57.32 %
Crystal growTemperature: 298 K / Method: vapor diffusion, hanging drop / pH: 6.2
Details: Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, ...Details: Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K
Crystal grow
*PLUS
Components of the solutions
*PLUS
IDConc.Common nameCrystal-IDSol-IDChemical formula
120 %(w/v)PEG20001drop
20.1 Msodium cacodylate1drop
30.2 M1dropNaF
45 mM1dropMgCl2
50.2 mMsucrose monolaurate1drop
610 %(v/v)PEG20001reservoir
750 mMsodium cacodylate1reservoir
80.1 M1reservoirNaF
95 mM1reservoirMgCl2
1040 %(v/v)glycerol1reservoir

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: NSLS / Beamline: X25 / Wavelength: 1.1 Å
DetectorType: BRANDEIS - B4 / Detector: CCD / Date: Jul 26, 2001 / Details: Wiggler
RadiationMonochromator: Si 111 channel / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1.1 Å / Relative weight: 1
ReflectionResolution: 2.8→37 Å / Num. all: 11002 / Num. obs: 11002 / % possible obs: 99.9 % / Observed criterion σ(F): 0 / Observed criterion σ(I): 0 / Redundancy: 7.1 % / Rmerge(I) obs: 0.08 / Net I/σ(I): 20.1
Reflection shellResolution: 2.8→2.9 Å / Redundancy: 7.1 % / Rmerge(I) obs: 0.501 / Mean I/σ(I) obs: 4.7 / Num. unique all: 1126 / % possible all: 100
Reflection
*PLUS
Rmerge(I) obs: 0.08
Reflection shell
*PLUS
% possible obs: 100 %

-
Processing

Software
NameVersionClassification
AMoREphasing
CNS1refinement
DENZOdata reduction
SCALEPACKdata scaling
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: PDB entry 1IM4
Resolution: 2.8→37 Å / Rfactor Rfree error: 0.008 / Data cutoff high absF: 617472.89 / Data cutoff low absF: 0 / Isotropic thermal model: RESTRAINED / Cross valid method: THROUGHOUT / σ(F): 0 / Stereochemistry target values: Engh & Huber
RfactorNum. reflection% reflectionSelection details
Rfree0.279 1159 10.5 %RANDOM
Rwork0.237 ---
all-11002 --
obs-11002 96.6 %-
Solvent computationSolvent model: FLAT MODEL / Bsol: 55.8395 Å2 / ksol: 0.380645 e/Å3
Displacement parametersBiso mean: 72.9 Å2
Baniso -1Baniso -2Baniso -3
1-9.28 Å219.43 Å20 Å2
2--10.26 Å20 Å2
3----19.54 Å2
Refine analyze
FreeObs
Luzzati coordinate error0.52 Å0.39 Å
Luzzati d res low-5 Å
Luzzati sigma a0.62 Å0.48 Å
Refinement stepCycle: LAST / Resolution: 2.8→37 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms2671 0 0 31 2702
Refine LS restraints
Refine-IDTypeDev idealDev ideal target
X-RAY DIFFRACTIONc_bond_d0.004
X-RAY DIFFRACTIONc_angle_deg0.9
X-RAY DIFFRACTIONc_dihedral_angle_d21.1
X-RAY DIFFRACTIONc_improper_angle_d0.7
X-RAY DIFFRACTIONc_mcbond_it1.241.5
X-RAY DIFFRACTIONc_mcangle_it2.142
X-RAY DIFFRACTIONc_scbond_it2.72
X-RAY DIFFRACTIONc_scangle_it3.462.5
LS refinement shellResolution: 2.8→2.98 Å / Rfactor Rfree error: 0.032 / Total num. of bins used: 6
RfactorNum. reflection% reflection
Rfree0.426 175 10.2 %
Rwork0.338 1537 -
obs--90.6 %
Xplor file
Refine-IDSerial noParam fileTopol file
X-RAY DIFFRACTION1PROTEIN_REP.PARAMPROTEIN.TOP
X-RAY DIFFRACTION2WATER_REP.PARAMWATER.TOP
Software
*PLUS
Name: CNS / Version: 1 / Classification: refinement
Refinement
*PLUS
σ(F): 0 / % reflection Rfree: 10.5 % / Rfactor obs: 0.237
Solvent computation
*PLUS
Displacement parameters
*PLUS
Biso mean: 72.9 Å2
Refine LS restraints
*PLUS
Refine-IDTypeDev idealDev ideal target
X-RAY DIFFRACTIONc_bond_d0.004
X-RAY DIFFRACTIONc_angle_deg0.9
X-RAY DIFFRACTIONc_dihedral_angle_d
X-RAY DIFFRACTIONc_dihedral_angle_deg21.1
X-RAY DIFFRACTIONc_improper_angle_d
X-RAY DIFFRACTIONc_improper_angle_deg0.7
X-RAY DIFFRACTIONc_mcbond_it1.5
X-RAY DIFFRACTIONc_scbond_it2
X-RAY DIFFRACTIONc_mcangle_it2
X-RAY DIFFRACTIONc_scangle_it2.5
LS refinement shell
*PLUS
Rfactor Rfree: 0.426 / % reflection Rfree: 10.2 % / Rfactor Rwork: 0.338

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbjlvh1.pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more