[English] 日本語
Yorodumi
- PDB-13gq: 95-bp double-stranded DNA minicircle: poly(A:T) model -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 13gq
Title95-bp double-stranded DNA minicircle: poly(A:T) model
Components(DNA (95-MER)) x 2
KeywordsDNA / DNA minicircle
Function / homologyDNA / DNA (> 10)
Function and homology information
Biological speciessynthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 5.27 Å
AuthorsLiu, Y. / Qin, P.Z.
Funding support United States, 3items
OrganizationGrant numberCountry
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R35GM145341 United States
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R35GM131901 United States
National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)R35GM127086 United States
CitationJournal: Nucleic Acids Res / Year: 2026
Title: Cryo-EM structure of a 95-base-pair double-stranded DNA minicircle at 5.3 Å resolution.
Authors: Yukang Liu / Kyu-Yeon Lee / Yao He / Donggyun Kim / Hongjian Chang / Vadim Cherezov / Juli Feigon / Peter Z Qin /
Abstract: Double-stranded DNA minicircles have been observed in a variety of biological settings and are also widely employed in biotechnology, therapeutic applications, and basic research. Here, we report a ...Double-stranded DNA minicircles have been observed in a variety of biological settings and are also widely employed in biotechnology, therapeutic applications, and basic research. Here, we report a cryo-EM structure of a 95-base-pair minicircle (dsMC95) at a 5.3 Å resolution. dsMC95 forms a closed ring as designed and no severe local duplex disruption is observed. The two DNA strands are fully resolved, with the major and minor grooves clearly distinguishable. Analysis reveals a nine-fold periodicity in the helical twist, which corresponds to approximately 10.56 base pairs per turn. Together with groove width analysis, the data indicate that dsMC95 maintains a B-DNA configuration. The dsMC95 ring exhibits modest in-plane ellipticity and small out-of-plane displacement, with outward-facing grooves widened and inward-facing ones compressed. The dsMC95 structure, which is the only free DNA cryo-EM structure with a resolution better than 6 Å to date, allows comparison to other structures to better understand DNA physical features such as bending. The findings advance our understanding of DNA structure under topological constraints and will inform studies of naturally occurring small circular DNA as well as the manipulation of DNA in nanotechnology applications.
History
DepositionMay 5, 2026Deposition site: RCSB / Processing site: RCSB
Revision 1.0Sep 30, 2026Provider: repository / Type: Initial release
Revision 1.0Sep 30, 2026Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
i: DNA (95-MER)
j: DNA (95-MER)


Theoretical massNumber of molelcules
Total (without water)58,5632
Polymers58,5632
Non-polymers00
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, not applicable
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

#1: DNA chain DNA (95-MER)


Mass: 29709.711 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: The deposited coordinates represent a surrogate poly(dA) sequence instead of the actual DNA sequence
Source: (synth.) synthetic construct (others)
#2: DNA chain DNA (95-MER)


Mass: 28853.314 Da / Num. of mol.: 1 / Source method: obtained synthetically
Details: The deposited coordinates represent a surrogate poly(dT) sequence instead of the actual DNA sequence.
Source: (synth.) synthetic construct (others)
Has protein modificationN
Sequence detailsThe coordinates contain an A-T only DNA model because the map does not support sequence-specific ...The coordinates contain an A-T only DNA model because the map does not support sequence-specific assignment. The actual DNA sequences are: CGATCAAGCCAGTGATAAGTGGAATGCCATGTGGTAAGATCGGTAGTCGTAGGCTCTCAA CTCGTATTCATCAACTGCATTCTGCCTACGACTAC and GTAGTCGTAGGCAGAATGCAGTTGATGAATACGAGTTGAGAGCCTACGACTACCGATCTT ACCACATGGCATTCCACTTATCACTGGCTTGATCG.

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

Component
IDNameTypeEntity IDParent-IDSource
1Synthetic 95-bp double-stranded DNA minicircleCOMPLEXall0SYNTHETIC
2DNA (95-MER)COMPLEX#11SYNTHETIC
3DNA (95-MER)COMPLEX#21SYNTHETIC
Molecular weight
IDEntity assembly-IDValue (°)Experimental value
110.0587 MDaNO
210.0293 MDaNO
310.0294 MDaNO
Source (natural)
IDEntity assembly-IDOrganismNcbi tax-ID
32synthetic construct (others)32630
43synthetic construct (others)32630
Buffer solutionpH: 8 / Details: 20 mM Tris-HCl (pH 8.0) and 1 mM EDTA
Buffer component
IDConc.NameBuffer-ID
120 mMTris(hydroxymethyl)aminomethane hydrochloride1
21 mMEthylenediaminetetraacetic acid disodium salt1
SpecimenConc.: 0.7 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3
VitrificationInstrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 298 K

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: TFS KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: BRIGHT FIELD / Nominal magnification: 165000 X / Nominal defocus max: 3000 nm / Nominal defocus min: 500 nm
Image recordingAverage exposure time: 3.5 sec. / Electron dose: 50 e/Å2 / Film or detector model: GATAN K3 (6k x 4k) / Num. of grids imaged: 1 / Num. of real images: 30028

-
Processing

EM software
IDNameCategory
1cryoSPARCparticle selection
2PHENIXmodel refinement
5cryoSPARCCTF correction
12cryoSPARCclassification
13cryoSPARC3D reconstruction
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
Particle selectionNum. of particles selected: 1412668
SymmetryPoint symmetry: C1 (asymmetric)
3D reconstructionResolution: 5.27 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 344629 / Num. of class averages: 1 / Symmetry type: POINT
RefinementCross valid method: NONE
Stereochemistry target values: GeoStd + Monomer Library + CDL v1.2
Displacement parametersBiso mean: 401.63 Å2
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00484368
ELECTRON MICROSCOPYf_angle_d0.79036737
ELECTRON MICROSCOPYf_chiral_restr0.0389760
ELECTRON MICROSCOPYf_plane_restr0.0054190
ELECTRON MICROSCOPYf_dihedral_angle_d30.08432274

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more