Journal: Nat Struct Mol Biol / Year: 2013 Title: Substrate-specific structural rearrangements of human Dicer. Authors: David W Taylor / Enbo Ma / Hideki Shigematsu / Michael A Cianfrocco / Cameron L Noland / Kuniaki Nagayama / Eva Nogales / Jennifer A Doudna / Hong-Wei Wang / Abstract: Dicer has a central role in RNA-interference pathways by cleaving double-stranded RNAs (dsRNAs) to produce small regulatory RNAs. Human Dicer can process long double-stranded and hairpin precursor ...Dicer has a central role in RNA-interference pathways by cleaving double-stranded RNAs (dsRNAs) to produce small regulatory RNAs. Human Dicer can process long double-stranded and hairpin precursor RNAs to yield short interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. Previous studies have shown that pre-miRNAs are cleaved more rapidly than pre-siRNAs in vitro and are the predominant natural Dicer substrates. We have used EM and single-particle analysis of Dicer-RNA complexes to gain insight into the structural basis for human Dicer's substrate preference. Our studies show that Dicer traps pre-siRNAs in a nonproductive conformation, whereas interactions of Dicer with pre-miRNAs and dsRNA-binding proteins induce structural changes in the enzyme that enable productive substrate recognition in the central catalytic channel. These findings implicate RNA structure and cofactors in determining substrate recognition and processing efficiency by human Dicer.
History
Deposition
Mar 9, 2013
-
Header (metadata) release
Mar 20, 2013
-
Map release
May 1, 2013
-
Update
Jun 19, 2013
-
Current status
Jun 19, 2013
Processing site: RCSB / Status: Released
-
Structure visualization
Movie
Surface view with section colored by density value
Name: 35 bp pre-siRNA / type: rna / ID: 2 / Name.synonym: 37ab Details: second single-stranded RNA used for duplex formation = UCGUGAACUUUCAAACUAUACAACCUACUACCUCAUU Classification: OTHER / Structure: DOUBLE HELIX / Synthetic?: Yes
Source (natural)
Organism: Homo sapiens (human) / synonym: Human
Molecular weight
Theoretical: 24 KDa
Sequence
String:
UGAGGUAGUA GGUUGUAUAG UUUGAAAGUU CACGAUU
-
Experimental details
-
Structure determination
Method
cryo EM
Processing
single particle reconstruction
Aggregation state
particle
-
Sample preparation
Concentration
0.05 mg/mL
Buffer
pH: 7.4 Details: 20 mM HEPES, pH 7.5, 150 mM KCl, 3 mM EDTA, 1 mM DTT, and 2.5% glycerol
Grid
Details: glow-discharged Quantifoil R 1.2/1.3 MO 200 mesh holey carbon grids
Vitrification
Cryogen name: ETHANE / Chamber humidity: 100 % / Instrument: FEI VITROBOT MARK IV Method: The samples were automatically blotted for 4-5 s at -2.5 mm offset before plunging.
-
Electron microscopy
Microscope
JEOL 3100FFC
Temperature
Min: 45 K / Max: 60 K / Average: 55 K
Alignment procedure
Legacy - Astigmatism: Objective lens astigmatism was corrected at 100,000 times magnification
Specialist optics
Energy filter - Name: JEOL / Energy filter - Lower energy threshold: 0.0 eV / Energy filter - Upper energy threshold: 20.0 eV
Date
Oct 10, 2009
Image recording
Category: CCD / Film or detector model: GENERIC GATAN (2k x 2k) / Number real images: 800 / Average electron dose: 20 e/Å2
Electron beam
Acceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
In the structure databanks used in Yorodumi, some data are registered as the other names, "COVID-19 virus" and "2019-nCoV". Here are the details of the virus and the list of structure data.
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)
EMDB accession codes are about to change! (news from PDBe EMDB page)
The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
The EM Navigator/Yorodumi systems omit the EMD- prefix.
Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator
Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.
Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi