[English] 日本語
Yorodumi
- EMDB-5602: Substrate-specific structural rearrangements of human Dicer -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: EMDB / ID: EMD-5602
TitleSubstrate-specific structural rearrangements of human Dicer
Map dataZernike phase-contrast cryo-EM reconstruction of Dicer-37ab
Sample
  • Sample: Human Dicer in complex with a 35 bp pre-siRNA
  • Protein or peptide: Endoribonuclease Dicer
  • RNA: 35 bp pre-siRNA
KeywordsRNA-mediated gene silencing / pre-miRNA processing / RNaseIII
Function / homology
Function and homology information


peripheral nervous system myelin formation / positive regulation of Schwann cell differentiation / global gene silencing by mRNA cleavage / negative regulation of Schwann cell proliferation / tRNA-derived small RNA (tsRNA or tRNA-related fragment, tRF) biogenesis / pre-miRNA binding / tRNA decay / ribonuclease III / Small interfering RNA (siRNA) biogenesis / apoptotic DNA fragmentation ...peripheral nervous system myelin formation / positive regulation of Schwann cell differentiation / global gene silencing by mRNA cleavage / negative regulation of Schwann cell proliferation / tRNA-derived small RNA (tsRNA or tRNA-related fragment, tRF) biogenesis / pre-miRNA binding / tRNA decay / ribonuclease III / Small interfering RNA (siRNA) biogenesis / apoptotic DNA fragmentation / deoxyribonuclease I activity / nerve development / positive regulation of myelination / miRNA metabolic process / RISC-loading complex / miRNA processing / ribonuclease III activity / RISC complex assembly / pre-miRNA processing / siRNA binding / M-decay: degradation of maternal mRNAs by maternally stored factors / siRNA processing / Regulation of MITF-M-dependent genes involved in apoptosis / RISC complex / MicroRNA (miRNA) biogenesis / negative regulation of tumor necrosis factor production / negative regulation of tumor necrosis factor-mediated signaling pathway / neuron projection morphogenesis / RNA endonuclease activity / helicase activity / double-stranded RNA binding / negative regulation of gene expression / protein domain specific binding / perinuclear region of cytoplasm / negative regulation of transcription by RNA polymerase II / RNA binding / extracellular exosome / ATP binding / metal ion binding / nucleus / cytosol / cytoplasm
Similarity search - Function
: / Dicer, double-stranded RNA-binding domain / Dicer, partner-binding domain / Dicer, dsRNA-binding domain / : / : / Dicer, platform domain / Dicer dimerisation domain / Dicer dimerisation domain / Dicer dimerisation domain superfamily ...: / Dicer, double-stranded RNA-binding domain / Dicer, partner-binding domain / Dicer, dsRNA-binding domain / : / : / Dicer, platform domain / Dicer dimerisation domain / Dicer dimerisation domain / Dicer dimerisation domain superfamily / Dicer dimerisation domain / Dicer double-stranded RNA-binding fold domain profile. / Ribonuclease III family signature. / Ribonuclease III domain / Ribonuclease III family domain profile. / Ribonuclease III family / Ribonuclease III domain / Ribonuclease III domain / PAZ domain superfamily / PAZ / PAZ domain / PAZ domain profile. / PAZ domain / PAZ domain / Double-stranded RNA binding motif / Ribonuclease III, endonuclease domain superfamily / Double stranded RNA-binding domain (dsRBD) profile. / Double-stranded RNA-binding domain / Double-stranded RNA-binding domain / DEAD/DEAH box helicase domain / DEAD/DEAH box helicase domain / DEAD/DEAH box helicase / Helicase conserved C-terminal domain / helicase superfamily c-terminal domain / Superfamilies 1 and 2 helicase C-terminal domain profile. / Superfamilies 1 and 2 helicase ATP-binding type-1 domain profile. / DEAD-like helicases superfamily / Helicase, C-terminal / Helicase, C-terminal / Helicase superfamily 1/2, ATP-binding domain / Helicase superfamily 1/2, ATP-binding domain / P-loop containing nucleoside triphosphate hydrolase
Similarity search - Domain/homology
Endoribonuclease Dicer
Similarity search - Component
Biological speciesHomo sapiens (human)
Methodsingle particle reconstruction / cryo EM / Resolution: 29.0 Å
AuthorsTaylor DW / Ma E / Shigematsu H / Cianfrocco MA / Noland CL / Nagayama K / Nogales E / Doudna JA / Wang HW
CitationJournal: Nat Struct Mol Biol / Year: 2013
Title: Substrate-specific structural rearrangements of human Dicer.
Authors: David W Taylor / Enbo Ma / Hideki Shigematsu / Michael A Cianfrocco / Cameron L Noland / Kuniaki Nagayama / Eva Nogales / Jennifer A Doudna / Hong-Wei Wang /
Abstract: Dicer has a central role in RNA-interference pathways by cleaving double-stranded RNAs (dsRNAs) to produce small regulatory RNAs. Human Dicer can process long double-stranded and hairpin precursor ...Dicer has a central role in RNA-interference pathways by cleaving double-stranded RNAs (dsRNAs) to produce small regulatory RNAs. Human Dicer can process long double-stranded and hairpin precursor RNAs to yield short interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. Previous studies have shown that pre-miRNAs are cleaved more rapidly than pre-siRNAs in vitro and are the predominant natural Dicer substrates. We have used EM and single-particle analysis of Dicer-RNA complexes to gain insight into the structural basis for human Dicer's substrate preference. Our studies show that Dicer traps pre-siRNAs in a nonproductive conformation, whereas interactions of Dicer with pre-miRNAs and dsRNA-binding proteins induce structural changes in the enzyme that enable productive substrate recognition in the central catalytic channel. These findings implicate RNA structure and cofactors in determining substrate recognition and processing efficiency by human Dicer.
History
DepositionMar 9, 2013-
Header (metadata) releaseMar 20, 2013-
Map releaseMay 1, 2013-
UpdateJun 19, 2013-
Current statusJun 19, 2013Processing site: RCSB / Status: Released

-
Structure visualization

Movie
  • Surface view with section colored by density value
  • Surface level: 1.3
  • Imaged by UCSF Chimera
  • Download
  • Surface view colored by radius
  • Surface level: 1.3
  • Imaged by UCSF Chimera
  • Download
Movie viewer
Structure viewerEM map:
SurfViewMolmilJmol/JSmol
Supplemental images

Downloads & links

-
Map

FileDownload / File: emd_5602.map.gz / Format: CCP4 / Size: 2.7 MB / Type: IMAGE STORED AS FLOATING POINT NUMBER (4 BYTES)
AnnotationZernike phase-contrast cryo-EM reconstruction of Dicer-37ab
Projections & slices

Image control

Size
Brightness
Contrast
Others
AxesZ (Sec.)Y (Row.)X (Col.)
3.07 Å/pix.
x 90 pix.
= 276.3 Å
3.07 Å/pix.
x 90 pix.
= 276.3 Å
3.07 Å/pix.
x 90 pix.
= 276.3 Å

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider.

Voxel sizeX=Y=Z: 3.07 Å
Density
Contour LevelBy AUTHOR: 1.3 / Movie #1: 1.3
Minimum - Maximum-2.56173587 - 21.684606550000002
Average (Standard dev.)0.0 (±0.99999928)
SymmetrySpace group: 1
Details

EMDB XML:

Map geometry
Axis orderXYZ
Origin-45-45-45
Dimensions909090
Spacing909090
CellA=B=C: 276.3 Å
α=β=γ: 90.0 °

CCP4 map header:

modeImage stored as Reals
Å/pix. X/Y/Z3.073.073.07
M x/y/z909090
origin x/y/z0.0000.0000.000
length x/y/z276.300276.300276.300
α/β/γ90.00090.00090.000
start NX/NY/NZ-132-122-147
NX/NY/NZ250274261
MAP C/R/S123
start NC/NR/NS-45-45-45
NC/NR/NS909090
D min/max/mean-2.56221.685-0.000

-
Supplemental data

-
Sample components

-
Entire : Human Dicer in complex with a 35 bp pre-siRNA

EntireName: Human Dicer in complex with a 35 bp pre-siRNA
Components
  • Sample: Human Dicer in complex with a 35 bp pre-siRNA
  • Protein or peptide: Endoribonuclease Dicer
  • RNA: 35 bp pre-siRNA

-
Supramolecule #1000: Human Dicer in complex with a 35 bp pre-siRNA

SupramoleculeName: Human Dicer in complex with a 35 bp pre-siRNA / type: sample / ID: 1000 / Oligomeric state: monomer / Number unique components: 2
Molecular weightTheoretical: 250 KDa

-
Macromolecule #1: Endoribonuclease Dicer

MacromoleculeName: Endoribonuclease Dicer / type: protein_or_peptide / ID: 1 / Name.synonym: Dicer, Helicase with RNase motif / Number of copies: 1 / Oligomeric state: monomer / Recombinant expression: Yes / Database: NCBI
Source (natural)Organism: Homo sapiens (human) / synonym: Human
Molecular weightTheoretical: 220 KDa
SequenceUniProtKB: Endoribonuclease Dicer / GO: pre-miRNA processing
InterPro: Ribonuclease III domain, PAZ domain, Helicase, C-terminal, Helicase superfamily 1/2, ATP-binding domain, Double-stranded RNA-binding domain, INTERPRO: IPR001159, DEAD/DEAH box helicase ...InterPro: Ribonuclease III domain, PAZ domain, Helicase, C-terminal, Helicase superfamily 1/2, ATP-binding domain, Double-stranded RNA-binding domain, INTERPRO: IPR001159, DEAD/DEAH box helicase domain, Dicer dimerisation domain

-
Macromolecule #2: 35 bp pre-siRNA

MacromoleculeName: 35 bp pre-siRNA / type: rna / ID: 2 / Name.synonym: 37ab
Details: second single-stranded RNA used for duplex formation = UCGUGAACUUUCAAACUAUACAACCUACUACCUCAUU
Classification: OTHER / Structure: DOUBLE HELIX / Synthetic?: Yes
Source (natural)Organism: Homo sapiens (human) / synonym: Human
Molecular weightTheoretical: 24 KDa
SequenceString:
UGAGGUAGUA GGUUGUAUAG UUUGAAAGUU CACGAUU

-
Experimental details

-
Structure determination

Methodcryo EM
Processingsingle particle reconstruction
Aggregation stateparticle

-
Sample preparation

Concentration0.05 mg/mL
BufferpH: 7.4
Details: 20 mM HEPES, pH 7.5, 150 mM KCl, 3 mM EDTA, 1 mM DTT, and 2.5% glycerol
GridDetails: glow-discharged Quantifoil R 1.2/1.3 MO 200 mesh holey carbon grids
VitrificationCryogen name: ETHANE / Chamber humidity: 100 % / Instrument: FEI VITROBOT MARK IV
Method: The samples were automatically blotted for 4-5 s at -2.5 mm offset before plunging.

-
Electron microscopy

MicroscopeJEOL 3100FFC
TemperatureMin: 45 K / Max: 60 K / Average: 55 K
Alignment procedureLegacy - Astigmatism: Objective lens astigmatism was corrected at 100,000 times magnification
Specialist opticsEnergy filter - Name: JEOL / Energy filter - Lower energy threshold: 0.0 eV / Energy filter - Upper energy threshold: 20.0 eV
DateOct 10, 2009
Image recordingCategory: CCD / Film or detector model: GENERIC GATAN (2k x 2k) / Number real images: 800 / Average electron dose: 20 e/Å2
Electron beamAcceleration voltage: 300 kV / Electron source: FIELD EMISSION GUN
Electron opticsCalibrated magnification: 100000 / Illumination mode: FLOOD BEAM / Imaging mode: BRIGHT FIELD / Cs: 3.7 mm / Nominal defocus max: 0.0 µm / Nominal defocus min: 0.0 µm / Nominal magnification: 60000
Sample stageSpecimen holder: Liquid helium cooled stage maintained at 55 K
Specimen holder model: JEOL

-
Image processing

CTF correctionDetails: each micrograph
Final reconstructionAlgorithm: OTHER / Resolution.type: BY AUTHOR / Resolution: 29.0 Å / Resolution method: FSC 0.5 CUT-OFF / Software - Name: SPIDER / Number images used: 6200

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more