[English] 日本語
Yorodumi- PDB-8ogj: Structure of Candida albicans 80S ribosome in complex with mefloquine -
+
Open data
-
Basic information
| Entry | Database: PDB / ID: 8ogj | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Title | Structure of Candida albicans 80S ribosome in complex with mefloquine | |||||||||||||||
Components |
| |||||||||||||||
Keywords | RIBOSOME / Candida albicans / mefloquine | |||||||||||||||
| Function / homology | Function and homology informationfilamentous growth of a population of unicellular organisms in response to neutral pH / cellular response to neutral pH / filamentous growth of a population of unicellular organisms in response to starvation / filamentous growth of a population of unicellular organisms in response to biotic stimulus / negative regulation of cell integrity MAPK cascade / positive regulation of conjugation with cellular fusion / yeast-form cell wall / regulation of cytoplasmic translation / GCN2-mediated signaling / invasive growth in response to glucose limitation ...filamentous growth of a population of unicellular organisms in response to neutral pH / cellular response to neutral pH / filamentous growth of a population of unicellular organisms in response to starvation / filamentous growth of a population of unicellular organisms in response to biotic stimulus / negative regulation of cell integrity MAPK cascade / positive regulation of conjugation with cellular fusion / yeast-form cell wall / regulation of cytoplasmic translation / GCN2-mediated signaling / invasive growth in response to glucose limitation / hyphal cell wall / negative regulation of p38MAPK cascade / ribosome hibernation / preribosome / filamentous growth / regulation of amino acid metabolic process / negative regulation of glucose mediated signaling pathway / positive regulation of translational fidelity / ribosome-associated ubiquitin-dependent protein catabolic process / pre-mRNA 5'-splice site binding / GDP-dissociation inhibitor activity / nonfunctional rRNA decay / cleavage in ITS2 between 5.8S rRNA and LSU-rRNA of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / preribosome, small subunit precursor / mRNA destabilization / negative regulation of mRNA splicing, via spliceosome / preribosome, large subunit precursor / signaling receptor activator activity / negative regulation of translational frameshifting / translational elongation / G-protein alpha-subunit binding / 90S preribosome / endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / ribosomal subunit export from nucleus / translational termination / protein-RNA complex assembly / endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / protein-membrane adaptor activity / translation regulator activity / ribosomal small subunit export from nucleus / DNA-(apurinic or apyrimidinic site) endonuclease activity / positive regulation of autophagy / rescue of stalled cytosolic ribosome / cytosolic ribosome / protein kinase C binding / cellular response to starvation / ribosomal large subunit biogenesis / maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) / maturation of SSU-rRNA / small-subunit processome / maintenance of translational fidelity / modification-dependent protein catabolic process / protein tag activity / rRNA processing / large ribosomal subunit / extracellular vesicle / ribosomal small subunit assembly / ribosome biogenesis / ribosome binding / ribosomal small subunit biogenesis / 5S rRNA binding / ribosomal large subunit assembly / small ribosomal subunit / small ribosomal subunit rRNA binding / large ribosomal subunit rRNA binding / cytosolic small ribosomal subunit / cytosolic large ribosomal subunit / cytoplasmic translation / cell adhesion / negative regulation of translation / rRNA binding / structural constituent of ribosome / protein ubiquitination / ribosome / translation / G protein-coupled receptor signaling pathway / ribonucleoprotein complex / mRNA binding / ubiquitin protein ligase binding / nucleolus / cell surface / RNA binding / extracellular region / zinc ion binding / metal ion binding / nucleus / cytoplasm / cytosol Similarity search - Function | |||||||||||||||
| Biological species | Candida albicans (yeast) | |||||||||||||||
| Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.1 Å | |||||||||||||||
Authors | Kolosova, O. / Zgadzay, Y. / Stetsenko, A. / Guskov, A. / Yusupov, M. | |||||||||||||||
| Funding support | France, Russian Federation, 4items
| |||||||||||||||
Citation | Journal: Proc.Natl.Acad.Sci.USA / Year: 2025Title: Mechanism of read-through enhancement by aminoglycosides and mefloquine Authors: Kolosova, O. / Zgadzay, Y. / Yusupov, M. | |||||||||||||||
| History |
|
-
Structure visualization
| Structure viewer | Molecule: Molmil Jmol/JSmol |
|---|
-
Downloads & links
-
Download
| PDBx/mmCIF format | 8ogj.cif.gz | 4.3 MB | Display | PDBx/mmCIF format |
|---|---|---|---|---|
| PDB format | pdb8ogj.ent.gz | Display | PDB format | |
| PDBx/mmJSON format | 8ogj.json.gz | Tree view | PDBx/mmJSON format | |
| Others | Other downloads |
-Validation report
| Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/og/8ogj ftp://data.pdbj.org/pub/pdb/validation_reports/og/8ogj | HTTPS FTP |
|---|
-Related structure data
| Related structure data | ![]() 16874MC ![]() 8cq7C ![]() 8cqwC ![]() 8creC ![]() 8oeqC ![]() 8oh6C ![]() 8oi5C ![]() 8oj3C C: citing same article ( M: map data used to model this data |
|---|---|
| Similar structure data | Similarity search - Function & homology F&H Search |
-
Links
-
Assembly
| Deposited unit | ![]()
|
|---|---|
| 1 |
|
-
Components
-RNA chain , 5 types, 5 molecules 13410A
| #1: RNA chain | Mass: 1085278.125 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: XR_002086444.1 |
|---|---|
| #2: RNA chain | Mass: 38943.129 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: X16634.1 |
| #3: RNA chain | Mass: 50683.906 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: OQ195134.1 |
| #4: RNA chain | Mass: 24385.453 Da / Num. of mol.: 1 / Source method: isolated from a natural source Details: correct sequence GGCAGCAUAGCUCAGUUGGUUAGAGCGUAGGACUCAUAAGCCUAAGGUCACUGGUUCAAUUCCAGUUCUGCUACCA (GGCAG-gap-CUGCUACCA) Source: (natural) Candida albicans (yeast) |
| #46: RNA chain | Mass: 575838.625 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: GenBank: XR_002086442.1 |
+60S ribosomal protein ... , 37 types, 37 molecules jklmnopqrstuvyz025678AAABACADAEAFAGAHAJ...
-Ribosomal protein ... , 10 types, 10 molecules wx9AIDEGKVY
| #18: Protein | Mass: 22685.850 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ56 |
|---|---|
| #19: Protein | Mass: 21002.861 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BUG0 |
| #28: Protein | Mass: 14215.550 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F3X2 |
| #37: Protein | Mass: 14118.759 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F6B7 |
| #49: Protein | Mass: 26917.314 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BZ90 |
| #50: Protein | Mass: 27313.570 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYS1 |
| #52: Protein | Mass: 25319.922 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BS29 |
| #56: Protein | Mass: 21765.146 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F1X2 |
| #67: Protein | Mass: 13366.540 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6BYJ9 |
| #70: Protein | Mass: 16000.784 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: A0A8H6F0V0 |
+40S ribosomal protein ... , 25 types, 25 molecules BCFHIJLMNOPQRSTUWXZabcdef
-Protein , 2 types, 2 molecules gh
| #78: Protein | Mass: 22615.525 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: Q5A109 |
|---|---|
| #79: Protein | Mass: 34593.934 Da / Num. of mol.: 1 / Source method: isolated from a natural source / Source: (natural) Candida albicans (yeast) / References: UniProt: P83774 |
-Non-polymers , 4 types, 441 molecules 






| #80: Chemical | | #81: Chemical | ChemComp-SPK / | #82: Chemical | ChemComp-MG / #83: Chemical | ChemComp-ZN / |
|---|
-Details
| Has ligand of interest | Y |
|---|---|
| Has protein modification | Y |
-Experimental details
-Experiment
| Experiment | Method: ELECTRON MICROSCOPY |
|---|---|
| EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-
Sample preparation
| Component | Name: Candida albicans 80S ribosome in complex with mefloquine Type: RIBOSOME / Entity ID: #1-#79 / Source: NATURAL |
|---|---|
| Molecular weight | Value: 3.3 MDa / Experimental value: YES |
| Source (natural) | Organism: Candida albicans (yeast) |
| Buffer solution | pH: 7.5 |
| Specimen | Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
| Vitrification | Cryogen name: ETHANE |
-
Electron microscopy imaging
| Experimental equipment | ![]() Model: Talos Arctica / Image courtesy: FEI Company |
|---|---|
| Microscopy | Model: FEI TALOS ARCTICA |
| Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 200 kV / Illumination mode: FLOOD BEAM |
| Electron lens | Mode: BRIGHT FIELD / Nominal defocus max: 16000 nm / Nominal defocus min: 5000 nm / Cs: 2.7 mm |
| Image recording | Electron dose: 47.3 e/Å2 / Film or detector model: GATAN K2 SUMMIT (4k x 4k) |
-
Processing
| EM software | Name: PHENIX / Version: 1.19rc4_4035: / Category: model refinement | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION | ||||||||||||||||||||||||
| 3D reconstruction | Resolution: 3.1 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 49801 / Symmetry type: POINT | ||||||||||||||||||||||||
| Atomic model building | Space: REAL | ||||||||||||||||||||||||
| Refine LS restraints |
|
Movie
Controller
About Yorodumi



Candida albicans (yeast)
France,
Russian Federation, 4items
Citation










PDBj
































FIELD EMISSION GUN