[English] 日本語
Yorodumi
- PDB-7z6h: Structure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 che... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 7z6h
TitleStructure of DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp
Components
  • (Cell cycle checkpoint ...) x 2
  • (Replication factor C subunit ...) x 4
  • Checkpoint protein HUS1
  • Hairpin DNA
KeywordsDNA BINDING PROTEIN / DNA damage checkpoint / Rad17-RFC / 9-1-1
Function / homology
Function and homology information


meiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / chromosome, telomeric repeat region / Rad17 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Elg1 RFC-like complex / DNA replication factor C complex / Ctf18 RFC-like complex / exodeoxyribonuclease III ...meiotic DNA integrity checkpoint signaling / checkpoint clamp complex / meiotic recombination checkpoint signaling / chromosome, telomeric repeat region / Rad17 RFC-like complex / positive regulation of DNA-directed DNA polymerase activity / Elg1 RFC-like complex / DNA replication factor C complex / Ctf18 RFC-like complex / exodeoxyribonuclease III / double-stranded DNA 3'-5' DNA exonuclease activity / regulation of phosphorylation / DNA clamp loader activity / Polymerase switching / DNA replication checkpoint signaling / embryo development ending in birth or egg hatching / 3'-5'-DNA exonuclease activity / mitotic DNA replication checkpoint signaling / protein localization to site of double-strand break / mitotic intra-S DNA damage checkpoint signaling / Polymerase switching on the C-strand of the telomere / chromatin-protein adaptor activity / DNA strand elongation involved in DNA replication / HDR through Single Strand Annealing (SSA) / DNA synthesis involved in DNA repair / negative regulation of DNA replication / Impaired BRCA2 binding to RAD51 / PCNA-Dependent Long Patch Base Excision Repair / Presynaptic phase of homologous DNA pairing and strand exchange / ATP-dependent activity, acting on DNA / Activation of ATR in response to replication stress / substantia nigra development / DNA damage checkpoint signaling / telomere maintenance / cellular response to ionizing radiation / Translesion synthesis by REV1 / Translesion synthesis by POLK / Translesion synthesis by POLI / Gap-filling DNA repair synthesis and ligation in GG-NER / nucleotide-excision repair / Termination of translesion DNA synthesis / Translesion Synthesis by POLH / SH3 domain binding / Recognition of DNA damage by PCNA-containing replication complex / double-strand break repair via homologous recombination / G2/M DNA damage checkpoint / DNA-templated DNA replication / HDR through Homologous Recombination (HRR) / histone deacetylase binding / Dual Incision in GG-NER / Dual incision in TC-NER / Gap-filling DNA repair synthesis and ligation in TC-NER / chromosome / site of double-strand break / Processing of DNA double-strand break ends / Regulation of TP53 Activity through Phosphorylation / damaged DNA binding / nuclear body / DNA replication / DNA repair / DNA damage response / nucleolus / protein kinase binding / chromatin / enzyme binding / ATP hydrolysis activity / DNA binding / nucleoplasm / ATP binding / nucleus / cytosol / cytoplasm
Similarity search - Function
Cell cycle checkpoint protein, Rad1 / Cell cycle checkpoint, Hus1 / Rad9 / Rad9 / Rad17 P-loop domain / Checkpoint protein Hus1/Mec3 / Hus1-like protein / Checkpoint protein Rad17/Rad24 / Checkpoint protein Rad17/Rad24, fungi/metazoa / Rad1/Rec1/Rad17 ...Cell cycle checkpoint protein, Rad1 / Cell cycle checkpoint, Hus1 / Rad9 / Rad9 / Rad17 P-loop domain / Checkpoint protein Hus1/Mec3 / Hus1-like protein / Checkpoint protein Rad17/Rad24 / Checkpoint protein Rad17/Rad24, fungi/metazoa / Rad1/Rec1/Rad17 / Rad9/Ddc1 / Repair protein Rad1/Rec1/Rad17 / Zinc Finger, Delta Prime; domain 3 - #10 / Zinc Finger, Delta Prime; domain 3 / Replication factor C subunit 3, C-terminal domain / RCF1/5-like, AAA+ ATPase lid domain / Replication factor C, C-terminal / Replication factor C C-terminal domain / : / DNA polymerase III, delta subunit / : / DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal / : / ATPase family associated with various cellular activities (AAA) / ATPase, AAA-type, core / P-loop containing nucleotide triphosphate hydrolases / ATPases associated with a variety of cellular activities / AAA+ ATPase domain / Up-down Bundle / Rossmann fold / P-loop containing nucleoside triphosphate hydrolase / 3-Layer(aba) Sandwich / Mainly Alpha / Alpha Beta
Similarity search - Domain/homology
PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER / DNA / DNA (> 10) / Cell cycle checkpoint protein RAD1 / Checkpoint protein HUS1 / Cell cycle checkpoint protein RAD17 / Replication factor C subunit 4 / Replication factor C subunit 2 / Replication factor C subunit 5 / Replication factor C subunit 3 / Cell cycle checkpoint control protein RAD9A
Similarity search - Component
Biological speciesHomo sapiens (human)
synthetic construct (others)
MethodELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 3.59 Å
AuthorsDay, M. / Oliver, A.W. / Pearl, L.H.
Funding support United Kingdom, 2items
OrganizationGrant numberCountry
Cancer Research UKC302/A14532 United Kingdom
Cancer Research UKC302/A24386 United Kingdom
CitationJournal: Nucleic Acids Res / Year: 2022
Title: Structure of the human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp bound to a dsDNA-ssDNA junction.
Authors: Matthew Day / Antony W Oliver / Laurence H Pearl /
Abstract: The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or ...The RAD9-RAD1-HUS1 (9-1-1) clamp forms one half of the DNA damage checkpoint system that signals the presence of substantial regions of single-stranded DNA arising from replication fork collapse or resection of DNA double strand breaks. Loaded at the 5'-recessed end of a dsDNA-ssDNA junction by the RAD17-RFC clamp loader complex, the phosphorylated C-terminal tail of the RAD9 subunit of 9-1-1 engages with the mediator scaffold TOPBP1 which in turn activates the ATR kinase, localised through the interaction of its constitutive partner ATRIP with RPA-coated ssDNA. Using cryogenic electron microscopy (cryoEM) we have determined the structure of a complex of the human RAD17-RFC clamp loader bound to human 9-1-1, engaged with a dsDNA-ssDNA junction. The structure answers the key questions of how RAD17 confers specificity for 9-1-1 over PCNA, and how the clamp loader specifically recognises the recessed 5' DNA end and fixes the orientation of 9-1-1 on the ssDNA.
History
DepositionMar 11, 2022Deposition site: PDBE / Processing site: PDBE
Revision 1.0May 4, 2022Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: EM metadata / Data content type: EM metadata / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: FSC / Data content type: FSC / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Half map / Part number: 1 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Half map / Part number: 2 / Data content type: Half map / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Image / Data content type: Image / Provider: repository / Type: Initial release
Revision 1.0May 4, 2022Data content type: Primary map / Data content type: Primary map / Provider: repository / Type: Initial release
Revision 1.1Aug 31, 2022Group: Database references / Category: citation
Item: _citation.country / _citation.journal_abbrev ..._citation.country / _citation.journal_abbrev / _citation.journal_id_ASTM / _citation.journal_id_CSD / _citation.journal_id_ISSN / _citation.journal_volume / _citation.page_first / _citation.page_last / _citation.pdbx_database_id_DOI / _citation.pdbx_database_id_PubMed / _citation.title / _citation.year
Revision 1.2Jul 9, 2025Group: Data collection / Structure summary
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / em_admin / em_software / pdbx_entry_details / pdbx_modification_feature
Item: _em_admin.last_update / _em_software.name / _pdbx_entry_details.has_protein_modification
Revision 1.1Jul 9, 2025Data content type: EM metadata / Data content type: EM metadata / EM metadata / Group: Data processing / Experimental summary / Data content type: EM metadata / EM metadata / Category: em_admin / em_software / Data content type: EM metadata / EM metadata / Item: _em_admin.last_update / _em_software.name
Revision 1.3Oct 1, 2025Group: Advisory / Data collection ...Advisory / Data collection / Derived calculations / Structure summary
Category: em_admin / pdbx_modification_feature ...em_admin / pdbx_modification_feature / pdbx_validate_close_contact / struct_conn / struct_conn_type
Item: _em_admin.last_update
Revision 1.2Oct 1, 2025Data content type: EM metadata / Data content type: EM metadata / Group: Experimental summary / Data content type: EM metadata / Category: em_admin / Data content type: EM metadata / Item: _em_admin.last_update

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Cell cycle checkpoint control protein RAD9A
B: Cell cycle checkpoint protein RAD1,Cell cycle checkpoint protein RAD17
C: Checkpoint protein HUS1
D: Replication factor C subunit 4
E: Replication factor C subunit 3
F: Replication factor C subunit 2
G: Replication factor C subunit 5
K: Cell cycle checkpoint protein RAD1,Cell cycle checkpoint protein RAD17
X: Hairpin DNA
Y: Hairpin DNA
hetero molecules


Theoretical massNumber of molelcules
Total (without water)516,74815
Polymers514,13210
Non-polymers2,6165
Water00
1


  • Idetical with deposited unit
  • defined by author
  • Evidence: electron microscopy, gel filtration, homology
TypeNameSymmetry operationNumber
identity operation1_5551

-
Components

-
Cell cycle checkpoint ... , 2 types, 3 molecules ABK

#1: Protein Cell cycle checkpoint control protein RAD9A / hRAD9 / DNA repair exonuclease rad9 homolog A


Mass: 44260.023 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RAD9A / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: Q99638, exodeoxyribonuclease III
#2: Protein Cell cycle checkpoint protein RAD1,Cell cycle checkpoint protein RAD17 / hRAD1 / DNA repair exonuclease rad1 homolog / Rad1-like DNA damage checkpoint protein / hRad17 / RF- ...hRAD1 / DNA repair exonuclease rad1 homolog / Rad1-like DNA damage checkpoint protein / hRad17 / RF-C/activator 1 homolog


Mass: 115195.578 Da / Num. of mol.: 2
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RAD1, REC1, RAD17, R24L / Production host: Spodoptera frugiperda (fall armyworm)
References: UniProt: O60671, UniProt: O75943, exodeoxyribonuclease III

-
Replication factor C subunit ... , 4 types, 4 molecules DEFG

#4: Protein Replication factor C subunit 4 / Activator 1 37 kDa subunit / A1 37 kDa subunit / Activator 1 subunit 4 / Replication factor C 37 ...Activator 1 37 kDa subunit / A1 37 kDa subunit / Activator 1 subunit 4 / Replication factor C 37 kDa subunit / RF-C 37 kDa subunit / RFC37


Mass: 39719.648 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RFC4 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: P35249
#5: Protein Replication factor C subunit 3 / Activator 1 38 kDa subunit / A1 38 kDa subunit / Activator 1 subunit 3 / Replication factor C 38 ...Activator 1 38 kDa subunit / A1 38 kDa subunit / Activator 1 subunit 3 / Replication factor C 38 kDa subunit / RF-C 38 kDa subunit / RFC38


Mass: 40614.332 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RFC3 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: P40938
#6: Protein Replication factor C subunit 2 / Activator 1 40 kDa subunit / A1 40 kDa subunit / Activator 1 subunit 2 / Replication factor C 40 ...Activator 1 40 kDa subunit / A1 40 kDa subunit / Activator 1 subunit 2 / Replication factor C 40 kDa subunit / RF-C 40 kDa subunit / RFC40


Mass: 39203.207 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RFC2 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: P35250
#7: Protein Replication factor C subunit 5 / Activator 1 36 kDa subunit / A1 36 kDa subunit / Activator 1 subunit 5 / Replication factor C 36 ...Activator 1 36 kDa subunit / A1 36 kDa subunit / Activator 1 subunit 5 / Replication factor C 36 kDa subunit / RF-C 36 kDa subunit / RFC36


Mass: 40688.816 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: RFC5 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: P40937

-
Protein / DNA chain / Non-polymers , 3 types, 8 molecules CXY

#3: Protein Checkpoint protein HUS1 / hHUS1


Mass: 31731.854 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: HUS1 / Production host: Spodoptera frugiperda (fall armyworm) / References: UniProt: O60921
#8: DNA chain Hairpin DNA


Mass: 23761.232 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped ...Details: DNA with the sequence CCCGTATATTCTCCTACAGCACTAAATAATAGTGCTGTAGGAGAATATACGGGCTGCTCGTGTTGACAAGTACTGAT which forms a hairpin DNA molecule with 24 base-pairs of fully-complementary dsDNA capped with a tetraloop at one end, and with a 24 nucleotide 3' overhang
Source: (synth.) synthetic construct (others)
#9: Chemical
ChemComp-AGS / PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER / ATP-GAMMA-S / ADENOSINE 5'-(3-THIOTRIPHOSPHATE) / ADENOSINE 5'-(GAMMA-THIOTRIPHOSPHATE) / ADENOSINE-5'-DIPHOSPHATE MONOTHIOPHOSPHATE


Mass: 523.247 Da / Num. of mol.: 5 / Source method: obtained synthetically / Formula: C10H16N5O12P3S / Feature type: SUBJECT OF INVESTIGATION / Comment: ATP-gamma-S, energy-carrying molecule analogue*YM

-
Details

Has ligand of interestY
Has protein modificationY

-
Experimental details

-
Experiment

ExperimentMethod: ELECTRON MICROSCOPY
EM experimentAggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction

-
Sample preparation

ComponentName: DNA-bound human RAD17-RFC clamp loader and 9-1-1 checkpoint clamp
Type: COMPLEX / Entity ID: #1-#8 / Source: RECOMBINANT
Molecular weightValue: 0.35 MDa / Experimental value: NO
Source (natural)Organism: Homo sapiens (human)
Source (recombinant)Organism: Spodoptera frugiperda (fall armyworm)
Buffer solutionpH: 7.5
SpecimenConc.: 0.21 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES
Specimen supportGrid material: COPPER / Grid type: Quantifoil R1.2/1.3
VitrificationCryogen name: ETHANE-PROPANE

-
Electron microscopy imaging

Experimental equipment
Model: Titan Krios / Image courtesy: FEI Company
MicroscopyModel: FEI TITAN KRIOS
Electron gunElectron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM
Electron lensMode: OTHER / Nominal defocus max: 2500 nm / Nominal defocus min: 1500 nm
Image recordingElectron dose: 34.9 e/Å2 / Film or detector model: FEI FALCON IV (4k x 4k)

-
Processing

SoftwareName: PHENIX / Version: 1.20.1_4487: / Classification: refinement
EM softwareName: PHENIX / Category: model refinement
CTF correctionType: PHASE FLIPPING AND AMPLITUDE CORRECTION
3D reconstructionResolution: 3.59 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 150626 / Num. of class averages: 1 / Symmetry type: POINT
Refine LS restraints
Refine-IDTypeDev idealNumber
ELECTRON MICROSCOPYf_bond_d0.00321048
ELECTRON MICROSCOPYf_angle_d0.59328586
ELECTRON MICROSCOPYf_dihedral_angle_d12.7543037
ELECTRON MICROSCOPYf_chiral_restr0.043320
ELECTRON MICROSCOPYf_plane_restr0.0053509

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more