-Query
![](data/pdb/img/1qwa.jpg)
PDB-1qwa:
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
-Search result
+
About F&H Search
-News
-Aug 12, 2020. Covid-19 info
Covid-19 info
![](../emnavi/img/about_covid19.jpg)
URL: https://pdbjlc1.pdbj.org/emnavi/covid19.php
New page: Covid-19 featured information page in EM Navigator.
Related info.:Covid-19 info /
Mar 5, 2020. Novel coronavirus structure data
-Mar 5, 2020. Novel coronavirus structure data
Novel coronavirus structure data
- International Committee on Taxonomy of Viruses (ICTV) defined the short name of the 2019 coronavirus as "SARS-CoV-2".
- In the structure databanks used in Yorodumi, some data are registered as the other names, "COVID-19 virus" and "2019-nCoV". Here are the details of the virus and the list of structure data.
Related info.:Yorodumi Speices /
Aug 12, 2020. Covid-19 info
External links:COVID-19 featured content - PDBj /
Molecule of the Month (242):Coronavirus Proteases
+Jul 12, 2017. Major update of PDB
Major update of PDB
- wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
- This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
- In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
- Now, EM Navigator and Yorodumi are based on the updated data.
External links:wwPDB Remediation /
Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive
+Jun 16, 2017. Omokage search with filter
Omokage search with filter
Result of Omokage search can be filtered by keywords and the database types
Related info.:Omokage search
+Apr 13, 2016. Omokage search got faster
Omokage search got faster
- The computation time became ~1/2 compared to the previous version by re-optimization of data accession.
- Enjoy "shape similarity" of biomolecules, more!
Related info.:Omokage search
-F&H Search
Function & Homology similarity search
Based on the similarity of Function & Homolog items related to the structure data, similar data are searched from structure databases.
Related info.:Function and homology information