[English] 日本語
Yorodumi- PDB-7s7b: Human Nuclear exosome targeting (NEXT) complex homodimer bound to... -
+Open data
-Basic information
Entry | Database: PDB / ID: 7s7b | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
Title | Human Nuclear exosome targeting (NEXT) complex homodimer bound to RNA (substrate 1) | |||||||||
Components |
| |||||||||
Keywords | RNA BINDING PROTEIN/RNA / Helicase / ATPase / RNA / Exosome / RNA BINDING PROTEIN / RNA BINDING PROTEIN-RNA complex | |||||||||
Function / homology | Function and homology information : / snRNA catabolic process / TRAMP complex / snRNA binding / RNA catabolic process / maturation of 5.8S rRNA / regulation of alternative mRNA splicing, via spliceosome / Major pathway of rRNA processing in the nucleolus and cytosol / pre-mRNA intronic binding / catalytic step 2 spliceosome ...: / snRNA catabolic process / TRAMP complex / snRNA binding / RNA catabolic process / maturation of 5.8S rRNA / regulation of alternative mRNA splicing, via spliceosome / Major pathway of rRNA processing in the nucleolus and cytosol / pre-mRNA intronic binding / catalytic step 2 spliceosome / mRNA Splicing - Major Pathway / 14-3-3 protein binding / meiotic cell cycle / rRNA processing / mRNA splicing, via spliceosome / single-stranded RNA binding / RNA helicase activity / nuclear body / RNA helicase / nuclear speck / DNA damage response / nucleolus / ATP hydrolysis activity / RNA binding / zinc ion binding / nucleoplasm / ATP binding / nucleus Similarity search - Function | |||||||||
Biological species | Homo sapiens (human) synthetic construct (others) | |||||||||
Method | ELECTRON MICROSCOPY / single particle reconstruction / cryo EM / Resolution: 4.06 Å | |||||||||
Authors | Puno, M.R. / Lima, C.D. | |||||||||
Funding support | United States, 2items
| |||||||||
Citation | Journal: Cell / Year: 2022 Title: Structural basis for RNA surveillance by the human nuclear exosome targeting (NEXT) complex. Authors: M Rhyan Puno / Christopher D Lima / Abstract: RNA quality control relies on co-factors and adaptors to identify and prepare substrates for degradation by ribonucleases such as the 3' to 5' ribonucleolytic RNA exosome. Here, we determined ...RNA quality control relies on co-factors and adaptors to identify and prepare substrates for degradation by ribonucleases such as the 3' to 5' ribonucleolytic RNA exosome. Here, we determined cryogenic electron microscopy structures of human nuclear exosome targeting (NEXT) complexes bound to RNA that reveal mechanistic insights to substrate recognition and early steps that precede RNA handover to the exosome. The structures illuminate ZCCHC8 as a scaffold, mediating homodimerization while embracing the MTR4 helicase and flexibly anchoring RBM7 to the helicase core. All three subunits collaborate to bind the RNA, with RBM7 and ZCCHC8 surveying sequences upstream of the 3' end to facilitate RNA capture by MTR4. ZCCHC8 obscures MTR4 surfaces important for RNA binding and extrusion as well as MPP6-dependent recruitment and docking onto the RNA exosome core, interactions that contribute to RNA surveillance by coordinating RNA capture, translocation, and extrusion from the helicase to the exosome for decay. | |||||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 7s7b.cif.gz | 502.6 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb7s7b.ent.gz | 402.8 KB | Display | PDB format |
PDBx/mmJSON format | 7s7b.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/s7/7s7b ftp://data.pdbj.org/pub/pdb/validation_reports/s7/7s7b | HTTPS FTP |
---|
-Related structure data
Related structure data | 24882MC 7s7cC M: map data used to model this data C: citing same article (ref.) |
---|---|
Similar structure data | Similarity search - Function & homologyF&H Search |
-Links
-Assembly
Deposited unit |
|
---|---|
1 |
|
-Components
#1: Protein | Mass: 118224.961 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: MTREX, DOB1, KIAA0052, MTR4, SKIV2L2 / Production host: Escherichia coli (E. coli) / References: UniProt: P42285, RNA helicase #2: Protein | Mass: 69259.805 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: ZCCHC8 / Production host: Escherichia coli (E. coli) / References: UniProt: Q6NZY4 #3: Protein | Mass: 9462.986 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Homo sapiens (human) / Gene: RBM7 / Production host: Escherichia coli (E. coli) / References: UniProt: Q9Y580 #4: RNA chain | Mass: 14605.818 Da / Num. of mol.: 2 / Source method: obtained synthetically Details: The actual RNA sequence is: ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAA(2PU)ACAAAAAAAA. (2PU) is represented by "N" (any nucleotide. This residue is missing in the coordinates and the chemical is an ...Details: The actual RNA sequence is: ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAA(2PU)ACAAAAAAAA. (2PU) is represented by "N" (any nucleotide. This residue is missing in the coordinates and the chemical is an internal 2' pyrene modified uridine Source: (synth.) synthetic construct (others) #5: Chemical | Has ligand of interest | N | |
---|
-Experimental details
-Experiment
Experiment | Method: ELECTRON MICROSCOPY |
---|---|
EM experiment | Aggregation state: PARTICLE / 3D reconstruction method: single particle reconstruction |
-Sample preparation
Component | Name: human Nuclear Exosome Targeting (NEXT)-RNA substrate 1 complex Type: COMPLEX / Entity ID: #1-#4 / Source: RECOMBINANT |
---|---|
Source (natural) | Organism: Homo sapiens (human) |
Source (recombinant) | Organism: Escherichia coli (E. coli) |
Buffer solution | pH: 8 Details: 20 mM Tris-Cl pH 8.0, 50 mM NaCl, 0.1 mM TCEP supplemented with 0.02% (v/v) IGEPAL CA-630 |
Specimen | Conc.: 8 mg/ml / Embedding applied: NO / Shadowing applied: NO / Staining applied: NO / Vitrification applied: YES |
Specimen support | Grid material: GOLD / Grid mesh size: 300 divisions/in. / Grid type: UltrAuFoil R1.2/1.3 |
Vitrification | Instrument: FEI VITROBOT MARK IV / Cryogen name: ETHANE / Humidity: 100 % / Chamber temperature: 295 K / Details: 30 s wait time, blot for 2.5 s before plunging |
-Electron microscopy imaging
Experimental equipment | Model: Titan Krios / Image courtesy: FEI Company |
---|---|
Microscopy | Model: FEI TITAN KRIOS |
Electron gun | Electron source: FIELD EMISSION GUN / Accelerating voltage: 300 kV / Illumination mode: FLOOD BEAM |
Electron lens | Mode: BRIGHT FIELDBright-field microscopy |
Image recording | Electron dose: 67.6 e/Å2 / Detector mode: SUPER-RESOLUTION / Film or detector model: GATAN K2 SUMMIT (4k x 4k) |
-Processing
EM software | Name: RELION / Category: 3D reconstruction |
---|---|
CTF correction | Type: PHASE FLIPPING AND AMPLITUDE CORRECTION |
3D reconstruction | Resolution: 4.06 Å / Resolution method: FSC 0.143 CUT-OFF / Num. of particles: 618412 Details: A total of 618,412 particles were used for the consensus reconstruction with an overall resolution of 4.06 Angstrom (FSC 0.143 cut off). Focused 3D classification and local refinement were ...Details: A total of 618,412 particles were used for the consensus reconstruction with an overall resolution of 4.06 Angstrom (FSC 0.143 cut off). Focused 3D classification and local refinement were performed in several regions of the complex. A composite map was generated using focused reconstructions of ZCCHC8 HD/KID-MTR4 KOW (3.26 Angstrom, FSC = 0.143; 117,561 particles), protomer A MTR4 (3.42 Angstrom, FSC = 0.143; 225,213 particles), protomer B MTR4 (3.54 Angstrom, FSC = 0.143; 236,602 particles), protomer A MTR4 core-ZCCHC8 PSP-RBM7 RRM (4.06 Angstrom, FSC = 0.143; 44,800 particles), and protomer B MTR4 core-ZCCHC8 PSP-RBM7 RRM (4.4 Angstrom, FSC = 0.143 37,088 particles). Symmetry type: POINT |