[English] 日本語
Yorodumi
- PDB-6pw2: Structural Basis for Cooperative Binding of EBNA1 to the Epstein-... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 6pw2
TitleStructural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr Virus Dyad Symmetry Minimal Origin of Replication
Components
  • DNA (62-MER)
  • DNA (62-MER) complementary DNA strand
  • Epstein-Barr nuclear antigen 1Epstein–Barr virus nuclear antigen 1
Keywordsviral protein/dna / EBNA1 / DNA binding protein / Epstein-Barr Virus / viral protein / viral protein-dna complex
Function / homology
Function and homology information


host cell PML body / symbiont-mediated suppression of host antigen processing and presentation / viral latency / Hydrolases; Acting on ester bonds; Endodeoxyribonucleases producing 5'-phosphomonoesters / enzyme-substrate adaptor activity / symbiont-mediated disruption of host cell PML body / regulation of DNA replication / virus-mediated perturbation of host defense response / endonuclease activity / DNA-binding transcription factor activity ...host cell PML body / symbiont-mediated suppression of host antigen processing and presentation / viral latency / Hydrolases; Acting on ester bonds; Endodeoxyribonucleases producing 5'-phosphomonoesters / enzyme-substrate adaptor activity / symbiont-mediated disruption of host cell PML body / regulation of DNA replication / virus-mediated perturbation of host defense response / endonuclease activity / DNA-binding transcription factor activity / positive regulation of DNA-templated transcription / DNA binding
Similarity search - Function
Epstein Barr virus nuclear antigen-1, DNA-binding domain / Epstein Barr virus nuclear antigen-1, DNA-binding / Epstein Barr virus nuclear antigen-1, DNA-binding domain / Epstein Barr virus nuclear antigen-1, DNA-binding domain superfamily / E2/EBNA1, C-terminal / Alpha-Beta Plaits / 2-Layer Sandwich / Alpha Beta
Similarity search - Domain/homology
DNA / DNA (> 10) / Epstein-Barr nuclear antigen 1
Similarity search - Component
Biological speciesEpstein-Barr virus (Epstein-Barr virus)
Human herpesvirus 4 strain B95-8 (Epstein-Barr virus (strain B95-8))
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 3.01 Å
AuthorsMessick, T.E. / Malecka, K.A. / Lieberman, P.M.
Funding support United Kingdom, 1items
OrganizationGrant numberCountry
Wellcome TrustWT096496 United Kingdom
CitationJournal: J.Virol. / Year: 2019
Title: Structural Basis for Cooperative Binding of EBNA1 to the Epstein-Barr Virus Dyad Symmetry Minimal Origin of Replication.
Authors: Malecka, K.A. / Dheekollu, J. / Deakyne, J.S. / Wiedmer, A. / Ramirez, U.D. / Lieberman, P.M. / Messick, T.E.
History
DepositionJul 22, 2019Deposition site: RCSB / Processing site: RCSB
Revision 1.0Aug 28, 2019Provider: repository / Type: Initial release
Revision 1.1Oct 9, 2019Group: Data collection / Database references / Category: citation / Item: _citation.journal_abbrev / _citation.journal_volume
Revision 1.2Oct 11, 2023Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
A: Epstein-Barr nuclear antigen 1
B: Epstein-Barr nuclear antigen 1
C: Epstein-Barr nuclear antigen 1
D: Epstein-Barr nuclear antigen 1
E: DNA (62-MER)
F: DNA (62-MER) complementary DNA strand
I: Epstein-Barr nuclear antigen 1
J: Epstein-Barr nuclear antigen 1
K: Epstein-Barr nuclear antigen 1
L: Epstein-Barr nuclear antigen 1
G: DNA (62-MER)
H: DNA (62-MER) complementary DNA strand


Theoretical massNumber of molelcules
Total (without water)204,49312
Polymers204,49312
Non-polymers00
Water724
1
A: Epstein-Barr nuclear antigen 1
B: Epstein-Barr nuclear antigen 1
C: Epstein-Barr nuclear antigen 1
D: Epstein-Barr nuclear antigen 1
E: DNA (62-MER)
F: DNA (62-MER) complementary DNA strand


Theoretical massNumber of molelcules
Total (without water)102,2476
Polymers102,2476
Non-polymers00
Water362
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area26210 Å2
ΔGint-143 kcal/mol
Surface area37500 Å2
MethodPISA
2
I: Epstein-Barr nuclear antigen 1
J: Epstein-Barr nuclear antigen 1
K: Epstein-Barr nuclear antigen 1
L: Epstein-Barr nuclear antigen 1
G: DNA (62-MER)
H: DNA (62-MER) complementary DNA strand


Theoretical massNumber of molelcules
Total (without water)102,2476
Polymers102,2476
Non-polymers00
Water362
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area26100 Å2
ΔGint-130 kcal/mol
Surface area34810 Å2
MethodPISA
Unit cell
Length a, b, c (Å)64.118, 283.384, 63.899
Angle α, β, γ (deg.)90.000, 89.800, 90.000
Int Tables number4
Space group name H-MP1211
Space group name HallP2yb
Symmetry operation#1: x,y,z
#2: -x,y+1/2,-z

-
Components

#1: Protein
Epstein-Barr nuclear antigen 1 / Epstein–Barr virus nuclear antigen 1 / EBV nuclear antigen 1


Mass: 16008.498 Da / Num. of mol.: 8
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Epstein-Barr virus (strain B95-8) (Epstein-Barr virus (strain B95-8))
Strain: B95-8 / Gene: EBNA1, BKRF1 / Production host: Escherichia coli BL21(DE3) (bacteria) / References: UniProt: P03211
#2: DNA chain DNA (62-MER)


Mass: 19128.277 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: CTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTA
Source: (synth.) Human herpesvirus 4 strain B95-8 (Epstein-Barr virus (strain B95-8))
#3: DNA chain DNA (62-MER) complementary DNA strand


Mass: 19084.285 Da / Num. of mol.: 2 / Source method: obtained synthetically
Details: CTAACCCTAATTCAATAGCATATGTTACCCAACGGGAAGCATATGCTATCGAATTAGGGTTA
Source: (synth.) Human herpesvirus 4 strain B95-8 (Epstein-Barr virus (strain B95-8))
#4: Water ChemComp-HOH / water / Water


Mass: 18.015 Da / Num. of mol.: 4 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 3.02 Å3/Da / Density % sol: 59.27 %
Crystal growTemperature: 298 K / Method: vapor diffusion, hanging drop / pH: 6.75 / Details: 200 mM sodium malonate, 24% PEG 3350 / PH range: +/- 0.25 / Temp details: +/- 2 degrees

-
Data collection

DiffractionMean temperature: 100 K / Ambient temp details: Cryostream / Serial crystal experiment: N
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 19-ID / Wavelength: 1 Å
DetectorType: DECTRIS PILATUS3 6M / Detector: PIXEL / Date: Nov 19, 2015
RadiationMonochromator: Si (111) Rosenbaum-Rock double-crystal monochromator
Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 1 Å / Relative weight: 1
ReflectionResolution: 3→50 Å / Num. obs: 29088 / % possible obs: 99.6 % / Redundancy: 10.6 % / Rsym value: 0.159 / Net I/σ(I): 8.1
Reflection shellResolution: 3→3.05 Å / Redundancy: 8.5 % / Mean I/σ(I) obs: 0.16 / Num. unique obs: 2264 / Rsym value: 2.682 / % possible all: 98.7

-
Processing

Software
NameClassification
PHENIXrefinement
HKL-3000data reduction
HKL-3000data scaling
PHASERphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 1B3T

1b3t


Resolution: 3.01→40.9 Å / Cross valid method: FREE R-VALUE
Details: TLS record as of below: tls = "chain 'A' and (resid 461 through 477 )" tls = "chain 'A' and (resid 478 through 491 )" tls = "chain 'A' and (resid 492 through 504 )" tls = "chain 'A' and ...Details: TLS record as of below: tls = "chain 'A' and (resid 461 through 477 )" tls = "chain 'A' and (resid 478 through 491 )" tls = "chain 'A' and (resid 492 through 504 )" tls = "chain 'A' and (resid 505 through 547 )" tls = "chain 'A' and (resid 548 through 560 )" tls = "chain 'A' and (resid 561 through 583 )" tls = "chain 'A' and (resid 584 through 599 )" tls = "chain 'A' and (resid 600 through 607 )" tls = "chain 'B' and (resid 461 through 477 )" tls = "chain 'B' and (resid 478 through 489 )" tls = "chain 'B' and (resid 490 through 513 )" tls = "chain 'B' and (resid 514 through 547 )" tls = "chain 'B' and (resid 548 through 560 )" tls = "chain 'B' and (resid 561 through 585 )" tls = "chain 'B' and (resid 586 through 607 )" tls = "chain 'C' and (resid 461 through 470 )" tls = "chain 'C' and (resid 471 through 477 )" tls = "chain 'C' and (resid 478 through 489 )" tls = "chain 'C' and (resid 490 through 513 )" tls = "chain 'C' and (resid 514 through 560 )" tls = "chain 'C' and (resid 561 through 568 )" tls = "chain 'C' and (resid 569 through 583 )" tls = "chain 'C' and (resid 584 through 607 )" tls = "chain 'D' and (resid 461 through 477 )" tls = "chain 'D' and (resid 478 through 537 )" tls = "chain 'D' and (resid 538 through 607 )" tls = "chain 'E' and (resid 3 through 17 )" tls = "chain 'E' and (resid 18 through 42 )" tls = "chain 'E' and (resid 43 through 57 )" tls = "chain 'E' and (resid 58 through 59 )" tls = "chain 'F' and (resid 5 through 24 )" tls = "chain 'F' and (resid 25 through 44 )" tls = "chain 'F' and (resid 45 through 54 )" tls = "chain 'F' and (resid 55 through 57 )" tls = "chain 'I' and (resid 461 through 477 )" tls = "chain 'I' and (resid 478 through 513 )" tls = "chain 'I' and (resid 514 through 537 )" tls = "chain 'I' and (resid 538 through 560 )" tls = "chain 'I' and (resid 561 through 599 )" tls = "chain 'I' and (resid 600 through 607 )" tls = "chain 'J' and (resid 461 through 478 )" tls = "chain 'J' and (resid 479 through 504 )" tls = "chain 'J' and (resid 505 through 537 )" tls = "chain 'J' and (resid 538 through 547 )" tls = "chain 'J' and (resid 548 through 560 )" tls = "chain 'J' and (resid 561 through 585 )" tls = "chain 'J' and (resid 586 through 599 )" tls = "chain 'J' and (resid 600 through 607 )" tls = "chain 'K' and (resid 461 through 477 )" tls = "chain 'K' and (resid 478 through 491 )" tls = "chain 'K' and (resid 492 through 513 )" tls = "chain 'K' and (resid 514 through 560 )" tls = "chain 'K' and (resid 561 through 568 )" tls = "chain 'K' and (resid 569 through 599 )" tls = "chain 'K' and (resid 600 through 607 )" tls = "chain 'L' and (resid 461 through 537 )" tls = "chain 'L' and (resid 538 through 607 )" tls = "chain 'G' and (resid 8 through 32 )" tls = "chain 'G' and (resid 33 through 52 )" tls = "chain 'G' and (resid 53 through 56 )" tls = "chain 'H' and (resid 7 through 21 )" tls = "chain 'H' and (resid 22 through 46 )" tls = "chain 'H' and (resid 47 through 55 )"
RfactorNum. reflection% reflectionSelection details
Rfree0.277 1977 -0.1
Rwork0.2199 ---
obs-28824 64.22 %-
Refinement stepCycle: LAST / Resolution: 3.01→40.9 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms9000 4266 0 4 13270
LS refinement shell

Refine-ID: X-RAY DIFFRACTION

Resolution (Å)Rfactor RfreeNum. reflection Rfree% reflection Rfree (%)Rfactor RworkNum. reflection Rwork% reflection obs (%)
3.0114-3.1190.3794238.30.36292536
3.119-3.24380.3055305.20.314154613
3.2438-3.39130.2859807.90.284692923
3.3913-3.57010.36351096.50.2961156137
3.5701-3.79360.37252217.10.307289570
3.7936-4.08620.43252956.90.3087395995
4.0862-4.4970.279331670.19734191100
4.497-5.14660.24353006.70.17914145100
5.1466-6.480.223066.70.20364236100
6.48-40.87990.20472976.70.1704413299

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242)：Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more