[English] 日本語
Yorodumi
- PDB-5t7b: Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modifie... -

+
Open data


ID or keywords:

Loading...

-
Basic information

Entry
Database: PDB / ID: 5t7b
TitleArgonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex
Components
  • Protein argonaute-2
  • RNA (UVP)UAUAGAGCAAGAACACUGUU
KeywordsHYDROLASE/RNA / RNAi / HYDROLASE-RNA complex
Function / homology
Function and homology information


: / endoribonuclease activity, cleaving miRNA-paired mRNA / endoribonuclease activity, cleaving siRNA-paired mRNA / siRNA-mediated gene silencing by mRNA destabilization / miRNA-mediated gene silencing by mRNA destabilization / Regulation of CDH11 mRNA translation by microRNAs / Regulation of NPAS4 mRNA translation / Post-transcriptional silencing by small RNAs / Competing endogenous RNAs (ceRNAs) regulate PTEN translation / Regulation of PTEN mRNA translation ...: / endoribonuclease activity, cleaving miRNA-paired mRNA / endoribonuclease activity, cleaving siRNA-paired mRNA / siRNA-mediated gene silencing by mRNA destabilization / miRNA-mediated gene silencing by mRNA destabilization / Regulation of CDH11 mRNA translation by microRNAs / Regulation of NPAS4 mRNA translation / Post-transcriptional silencing by small RNAs / Competing endogenous RNAs (ceRNAs) regulate PTEN translation / Regulation of PTEN mRNA translation / negative regulation of amyloid precursor protein biosynthetic process / Small interfering RNA (siRNA) biogenesis / Transcriptional Regulation by MECP2 / positive regulation of trophoblast cell migration / RNA secondary structure unwinding / miRNA metabolic process / RISC-loading complex / mRNA cap binding / regulatory ncRNA-mediated post-transcriptional gene silencing / : / RISC complex assembly / mRNA 3'-UTR AU-rich region binding / miRNA processing / pre-miRNA processing / miRNA-mediated gene silencing by inhibition of translation / siRNA processing / RNA 7-methylguanosine cap binding / siRNA binding / M-decay: degradation of maternal mRNAs by maternally stored factors / regulatory ncRNA-mediated gene silencing / RISC complex / Regulation of RUNX1 Expression and Activity / MicroRNA (miRNA) biogenesis / miRNA binding / positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay / positive regulation of nuclear-transcribed mRNA poly(A) tail shortening / RNA polymerase II complex binding / Regulation of MECP2 expression and activity / core promoter sequence-specific DNA binding / negative regulation of translational initiation / RNA endonuclease activity / NR1H3 & NR1H2 regulate gene expression linked to cholesterol transport and efflux / translation initiation factor activity / post-embryonic development / positive regulation of translation / P-body / TP53 Regulates Metabolic Genes / Transcriptional regulation by small RNAs / MAPK6/MAPK4 signaling / cytoplasmic ribonucleoprotein granule / Pre-NOTCH Transcription and Translation / positive regulation of angiogenesis / double-stranded RNA binding / Ca2+ pathway / Estrogen-dependent gene expression / single-stranded RNA binding / translation / dendrite / positive regulation of transcription by RNA polymerase II / RNA binding / extracellular exosome / nucleoplasm / membrane / metal ion binding / nucleus / cytosol / cytoplasm
Similarity search - Function
Protein argonaute-2 / paz domain / Protein argonaute, Mid domain / Argonaute-like, PIWI domain / Mid domain of argonaute / paz domain / Argonaute linker 2 domain / Protein argonaute, N-terminal / N-terminal domain of argonaute / Argonaute linker 2 domain ...Protein argonaute-2 / paz domain / Protein argonaute, Mid domain / Argonaute-like, PIWI domain / Mid domain of argonaute / paz domain / Argonaute linker 2 domain / Protein argonaute, N-terminal / N-terminal domain of argonaute / Argonaute linker 2 domain / DUF1785 / Argonaute, linker 1 domain / Argonaute linker 1 domain / Piwi domain / Piwi domain profile. / Piwi domain / Piwi / PAZ domain superfamily / PAZ / PAZ domain / PAZ domain / PAZ domain profile. / Response regulator / Beta Complex / Ribonuclease H-like superfamily/Ribonuclease H / Nucleotidyltransferase; domain 5 / Ribonuclease H superfamily / Ribonuclease H-like superfamily / Rossmann fold / 2-Layer Sandwich / 3-Layer(aba) Sandwich / Mainly Beta / Alpha Beta
Similarity search - Domain/homology
PHENOL / RNA / RNA (> 10) / Protein argonaute-2
Similarity search - Component
Biological speciesHomo sapiens (human)
Mus musculus (house mouse)
MethodX-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / Resolution: 2.529 Å
AuthorsElkayam, E. / Joshua-Tor, L.
Funding support United States, 1items
OrganizationGrant numberCountry
Howard Hughes Medical Institute (HHMI) United States
CitationJournal: To Be Published
Title: Protein structure
Authors: Elkayam, E. / Joshua-Tor, L.
History
DepositionSep 2, 2016Deposition site: RCSB / Processing site: RCSB
Revision 1.0Dec 14, 2016Provider: repository / Type: Initial release
Revision 1.1Nov 20, 2019Group: Author supporting evidence / Category: pdbx_audit_support / Item: _pdbx_audit_support.funding_organization
Revision 1.2Oct 4, 2023Group: Data collection / Database references / Refinement description
Category: chem_comp_atom / chem_comp_bond ...chem_comp_atom / chem_comp_bond / database_2 / pdbx_initial_refinement_model
Item: _database_2.pdbx_DOI / _database_2.pdbx_database_accession

-
Structure visualization

Structure viewerMolecule:
MolmilJmol/JSmol

Downloads & links

-
Assembly

Deposited unit
R: RNA (UVP)UAUAGAGCAAGAACACUGUU
A: Protein argonaute-2
hetero molecules


Theoretical massNumber of molelcules
Total (without water)104,3984
Polymers104,2092
Non-polymers1882
Water1629
1


  • Idetical with deposited unit
  • defined by author&software
TypeNameSymmetry operationNumber
identity operation1_555x,y,z1
Buried area4330 Å2
ΔGint-15 kcal/mol
Surface area37920 Å2
MethodPISA
Unit cell
Length a, b, c (Å)63.207, 108.306, 68.821
Angle α, β, γ (deg.)90.00, 106.62, 90.00
Int Tables number4
Space group name H-MP1211

-
Components

#1: RNA chain RNA (UVP)UAUAGAGCAAGAACACUGUU


Mass: 6733.099 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) Mus musculus (house mouse)
#2: Protein Protein argonaute-2 / hAgo2 / Argonaute RISC catalytic component 2 / Eukaryotic translation initiation factor 2C 2 / ...hAgo2 / Argonaute RISC catalytic component 2 / Eukaryotic translation initiation factor 2C 2 / eIF2C 2 / PAZ Piwi domain protein / PPD / Protein slicer


Mass: 97476.328 Da / Num. of mol.: 1
Source method: isolated from a genetically manipulated source
Source: (gene. exp.) Homo sapiens (human) / Gene: AGO2, EIF2C2 / Production host: Spodoptera frugiperda (fall armyworm)
References: UniProt: Q9UKV8, Hydrolases; Acting on ester bonds; Endoribonucleases producing 5'-phosphomonoesters
#3: Chemical ChemComp-IPH / PHENOL / Phenol


Mass: 94.111 Da / Num. of mol.: 2 / Source method: obtained synthetically / Formula: C6H6O
#4: Water ChemComp-HOH / water / Water


Mass: 18.015 Da / Num. of mol.: 9 / Source method: isolated from a natural source / Formula: H2O

-
Experimental details

-
Experiment

ExperimentMethod: X-RAY DIFFRACTION / Number of used crystals: 1

-
Sample preparation

CrystalDensity Matthews: 2.24 Å3/Da / Density % sol: 44.97 %
Crystal growTemperature: 290 K / Method: vapor diffusion
Details: 100 mM Tris pH=9.0, 10% PEG 3350 (w/v), 8% 2-propanol (v/v), 0.12 M phenol

-
Data collection

DiffractionMean temperature: 100 K
Diffraction sourceSource: SYNCHROTRON / Site: APS / Beamline: 19-ID / Wavelength: 0.97934 Å
DetectorType: ADSC QUANTUM 315r / Detector: CCD / Date: Nov 30, 2015
RadiationProtocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray
Radiation wavelengthWavelength: 0.97934 Å / Relative weight: 1
ReflectionResolution: 2.529→65.95 Å / Num. obs: 27742 / % possible obs: 93 % / Redundancy: 3.2 % / CC1/2: 0.998 / Rmerge(I) obs: 0.065 / Net I/σ(I): 14.2
Reflection shellResolution: 2.529→2.537 Å / Redundancy: 3.3 % / Rmerge(I) obs: 0.655 / Mean I/σ(I) obs: 2.2 / CC1/2: 0.695 / % possible all: 98.9

-
Processing

Software
NameVersionClassification
PHENIX(1.10.1_2155: ???)refinement
XDSdata reduction
SCALAdata scaling
PHASERphasing
RefinementMethod to determine structure: MOLECULAR REPLACEMENT
Starting model: 4F3T
Resolution: 2.529→65.946 Å / SU ML: 0.34 / Cross valid method: FREE R-VALUE / σ(F): 1.35 / Phase error: 25.6 / Stereochemistry target values: ML
RfactorNum. reflection% reflection
Rfree0.2383 1368 4.93 %
Rwork0.1935 --
obs0.1957 27737 93.33 %
Solvent computationShrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL
Refinement stepCycle: LAST / Resolution: 2.529→65.946 Å
ProteinNucleic acidLigandSolventTotal
Num. atoms6443 236 14 9 6702
Refine LS restraints
Refine-IDTypeDev idealNumber
X-RAY DIFFRACTIONf_bond_d0.0036870
X-RAY DIFFRACTIONf_angle_d0.5699339
X-RAY DIFFRACTIONf_dihedral_angle_d12.84161
X-RAY DIFFRACTIONf_chiral_restr0.0421046
X-RAY DIFFRACTIONf_plane_restr0.0041163
LS refinement shell
Resolution (Å)Rfactor RfreeNum. reflection RfreeRfactor RworkNum. reflection RworkRefine-ID% reflection obs (%)
2.5288-2.61920.28781470.25712783X-RAY DIFFRACTION99
2.6192-2.72410.3091180.25592082X-RAY DIFFRACTION75
2.7241-2.8480.27831300.23372818X-RAY DIFFRACTION99
2.848-2.99820.29531280.22922801X-RAY DIFFRACTION99
2.9982-3.1860.26171380.22772803X-RAY DIFFRACTION99
3.186-3.4320.26811420.21372722X-RAY DIFFRACTION98
3.432-3.77740.22631300.20162357X-RAY DIFFRACTION89
3.7774-4.32390.22621320.17752509X-RAY DIFFRACTION88
4.3239-5.44720.20911510.15712732X-RAY DIFFRACTION97
5.4472-65.96790.21811520.1732762X-RAY DIFFRACTION96
Refinement TLS params.

Method: refined / Refine-ID: X-RAY DIFFRACTION

IDL112)L122)L132)L222)L232)L332)S11 (Å °)S12 (Å °)S13 (Å °)S21 (Å °)S22 (Å °)S23 (Å °)S31 (Å °)S32 (Å °)S33 (Å °)T112)T122)T132)T222)T232)T332)Origin x (Å)Origin y (Å)Origin z (Å)
10.03310.2998-0.51614.4891-4.18823.8106-0.1229-0.1746-0.2078-0.0418-0.2649-0.04870.1851-0.04170.44560.52350.0098-0.07250.438-0.03230.609253.182329.131996.1948
22.1393-0.56060.3542.9472-0.69091.39470.04460.0106-0.57560.0214-0.0101-0.06430.4184-0.0601-0.05470.4938-0.04680.0040.3592-0.0450.333257.62474.101778.3669
30.68810.1301-0.20831.2175-1.27213.07690.05190.0255-0.20880.07570.10350.0854-0.1892-0.0505-0.14870.37640.0069-0.05140.36050.02470.422858.61749.235791.2321
41.84790.7359-0.81852.9928-0.94582.44520.079-0.0465-0.30010.1398-0.0778-0.009-0.1240.07610.00750.4687-0.0139-0.00790.41070.00290.401956.12231.3665122.1258
51.6545-0.12870.21741.7372-0.04540.8206-0.0326-0.41540.50720.41850.01940.1779-0.1652-0.14940.01380.4494-0.01830.04430.4385-0.07760.438145.185540.951994.2403
62.77680.3234-0.38831.26420.06271.1757-0.0167-0.11580.0340.09510.0180.28540.0825-0.10830.00840.2591-0.0092-0.01690.25330.03710.353239.250831.692983.0024
Refinement TLS group
IDRefine-IDRefine TLS-IDSelection details
1X-RAY DIFFRACTION1chain 'R' and (resid 2 through 21 )
2X-RAY DIFFRACTION2chain 'A' and (resid 23 through 102 )
3X-RAY DIFFRACTION3chain 'A' and (resid 103 through 269 )
4X-RAY DIFFRACTION4chain 'A' and (resid 270 through 346 )
5X-RAY DIFFRACTION5chain 'A' and (resid 347 through 641 )
6X-RAY DIFFRACTION6chain 'A' and (resid 642 through 859 )

+
About Yorodumi

-
News

-
Feb 9, 2022. New format data for meta-information of EMDB entries

New format data for meta-information of EMDB entries

  • Version 3 of the EMDB header file is now the official format.
  • The previous official version 1.9 will be removed from the archive.

Related info.:EMDB header

External links:wwPDB to switch to version 3 of the EMDB data model

-
Aug 12, 2020. Covid-19 info

Covid-19 info

URL: https://pdbj.org/emnavi/covid19.php

New page: Covid-19 featured information page in EM Navigator.

Related info.:Covid-19 info / Mar 5, 2020. Novel coronavirus structure data

+
Mar 5, 2020. Novel coronavirus structure data

Novel coronavirus structure data

Related info.:Yorodumi Speices / Aug 12, 2020. Covid-19 info

External links:COVID-19 featured content - PDBj / Molecule of the Month (242):Coronavirus Proteases

+
Jan 31, 2019. EMDB accession codes are about to change! (news from PDBe EMDB page)

EMDB accession codes are about to change! (news from PDBe EMDB page)

  • The allocation of 4 digits for EMDB accession codes will soon come to an end. Whilst these codes will remain in use, new EMDB accession codes will include an additional digit and will expand incrementally as the available range of codes is exhausted. The current 4-digit format prefixed with “EMD-” (i.e. EMD-XXXX) will advance to a 5-digit format (i.e. EMD-XXXXX), and so on. It is currently estimated that the 4-digit codes will be depleted around Spring 2019, at which point the 5-digit format will come into force.
  • The EM Navigator/Yorodumi systems omit the EMD- prefix.

Related info.:Q: What is EMD? / ID/Accession-code notation in Yorodumi/EM Navigator

External links:EMDB Accession Codes are Changing Soon! / Contact to PDBj

+
Jul 12, 2017. Major update of PDB

Major update of PDB

  • wwPDB released updated PDB data conforming to the new PDBx/mmCIF dictionary.
  • This is a major update changing the version number from 4 to 5, and with Remediation, in which all the entries are updated.
  • In this update, many items about electron microscopy experimental information are reorganized (e.g. em_software).
  • Now, EM Navigator and Yorodumi are based on the updated data.

External links:wwPDB Remediation / Enriched Model Files Conforming to OneDep Data Standards Now Available in the PDB FTP Archive

-
Yorodumi

Thousand views of thousand structures

  • Yorodumi is a browser for structure data from EMDB, PDB, SASBDB, etc.
  • This page is also the successor to EM Navigator detail page, and also detail information page/front-end page for Omokage search.
  • The word "yorodu" (or yorozu) is an old Japanese word meaning "ten thousand". "mi" (miru) is to see.

Related info.:EMDB / PDB / SASBDB / Comparison of 3 databanks / Yorodumi Search / Aug 31, 2016. New EM Navigator & Yorodumi / Yorodumi Papers / Jmol/JSmol / Function and homology information / Changes in new EM Navigator and Yorodumi

Read more