4PCV
 
 | | The structure of BdcA (YjgI) from E. coli | | Descriptor: | BdcA (YjgI), PENTAETHYLENE GLYCOL, TRIETHYLENE GLYCOL | | Authors: | Page, R, Peti, W, Lord, D. | | Deposit date: | 2014-04-16 | | Release date: | 2015-03-11 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | BdcA, a protein important for Escherichia coli biofilm dispersal, is a short-chain dehydrogenase/reductase that binds specifically to NADPH.
Plos One, 9, 2014
|
|
4P4Z
 | |
1O9N
 | |
4P5H
 | |
1NPS
 | | CRYSTAL STRUCTURE OF N-TERMINAL DOMAIN OF PROTEIN S | | Descriptor: | CALCIUM ION, DEVELOPMENT-SPECIFIC PROTEIN S | | Authors: | Wenk, M, Baumgartner, R, Mayer, E.M, Huber, R, Holak, T.A, Jaenicke, R. | | Deposit date: | 1999-02-01 | | Release date: | 2000-02-04 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | The domains of protein S from Myxococcus xanthus: structure, stability and interactions.
J.Mol.Biol., 286, 1999
|
|
4PD2
 | | Crystal structure of a complex between a C248GH LlFpg mutant and a THF containing DNA | | Descriptor: | DNA (5'-D(*CP*TP*CP*TP*TP*TP*(3DR)P*TP*TP*TP*CP*TP*CP*G)-3'), DNA (5'-D(*GP*CP*GP*AP*GP*AP*AP*AP*CP*AP*AP*AP*GP*A)-3'), Formamidopyrimidine-DNA glycosylase, ... | | Authors: | Coste, F, Castaing, B. | | Deposit date: | 2014-04-17 | | Release date: | 2015-04-01 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Zinc finger oxidation of Fpg/Nei DNA glycosylases by 2-thioxanthine: biochemical and X-ray structural characterization.
Nucleic Acids Res., 42, 2014
|
|
1OA6
 | |
1NQ0
 | | TR Receptor Mutations Conferring Hormone Resistance and Reduced Corepressor Release Exhibit Decreased Stability in the Nterminal LBD | | Descriptor: | ARSENIC, Thyroid hormone receptor beta-1, [4-(4-HYDROXY-3-IODO-PHENOXY)-3,5-DIIODO-PHENYL]-ACETIC ACID | | Authors: | Huber, B.R, Desclozeaux, M, West, B.L, Cunha-Lima, S.T, Nguyen, H.T, Baxter, J.D, Ingraham, H.A, Fletterick, R.J. | | Deposit date: | 2003-01-20 | | Release date: | 2003-04-15 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Thyroid hormone receptor-beta mutations conferring hormone resistance and reduced corepressor release exhibit decreased stability in the N-terminal ligand-binding domain
Mol.Endocrinol., 17, 2003
|
|
4PDB
 | |
1NQ9
 | | Crystal Structure of Antithrombin in the Pentasaccharide-Bound Intermediate State | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 3,4-di-O-methyl-2,6-di-O-sulfo-alpha-D-glucopyranose-(1-4)-2,3-di-O-methyl-beta-D-glucopyranuronic acid-(1-4)-2,3,6-tri-O-sulfo-alpha-D-glucopyranose-(1-4)-3-O-methyl-2-O-sulfo-alpha-L-idopyranuronic acid-(1-4)-methyl 2,3,6-tri-O-sulfo-alpha-D-glucopyranoside, ... | | Authors: | Huntington, J.A, Johnson, D.J.D. | | Deposit date: | 2003-01-21 | | Release date: | 2003-09-30 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal Structure of Antithrombin in a Heparin-Bound Intermediate State
Biochemistry, 42, 2003
|
|
4P7J
 | | Rat apo-COMT sulfate bound | | Descriptor: | Catechol O-methyltransferase, POTASSIUM ION, SULFATE ION | | Authors: | Ehler, A, Benz, J, Schlatter, D, Rudolph, M.G. | | Deposit date: | 2014-03-27 | | Release date: | 2014-06-18 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Mapping the conformational space accessible to catechol-O-methyltransferase.
Acta Crystallogr.,Sect.D, 70, 2014
|
|
1OA9
 | |
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
1NQS
 | | Structural Characterisation of the Holliday Junction formed by the sequence d(TCGGTACCGA) at 1.97 A | | Descriptor: | 5'-d(TpCpGpGpTpApCpCpGpA)-3', CALCIUM ION | | Authors: | Cardin, C.J, Gale, B.C, Thorpe, J.H, Texieira, S.C.M, Gan, Y, Moraes, M.I.A.A, Brogden, A.L. | | Deposit date: | 2003-01-22 | | Release date: | 2003-02-04 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Structural Analysis of two Holliday junctions formed by the sequences TCGGTACCGA and CCGGTACCGG
To be Published
|
|
1NQZ
 | | The structure of a CoA pyrophosphatase from D. Radiodurans complexed with a magnesium ion | | Descriptor: | CoA pyrophosphatase (MutT/nudix family protein), MAGNESIUM ION | | Authors: | Kang, L.W, Gabelli, S.B, Bianchet, M.A, Xu, W.L, Bessman, M.J, Amzel, L.M. | | Deposit date: | 2003-01-23 | | Release date: | 2003-05-13 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structure of a coenzyme A pyrophosphatase from Deinococcus radiodurans: a member of the Nudix family.
J.Bacteriol., 185, 2003
|
|
4P7R
 | | Structure of Escherichia coli PgaB C-terminal domain in complex with a poly-beta-1,6-N-acetyl-D-glucosamine (PNAG) hexamer | | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-6)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-6)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-6)-2-acetamido-2-deoxy-beta-D-glucopyranose, Poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase | | Authors: | Little, D.J, Li, G, Ing, C, DiFrancesco, B, Bamford, N.C, Robinson, H, Nitz, M, Pomes, R, Howell, P.L. | | Deposit date: | 2014-03-27 | | Release date: | 2014-07-02 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Modification and periplasmic translocation of the biofilm exopolysaccharide poly-beta-1,6-N-acetyl-D-glucosamine.
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4P9Y
 | | Structure of ConA/Rh4man | | Descriptor: | 2-{2-[2-(2-{4-[(alpha-D-mannopyranosyloxy)methyl]-1H-1,2,3-triazol-1-yl}ethoxy)ethoxy]ethoxy}ethyl 2-[3,6-bis(diethylamino)-9H-xanthen-9-yl]benzoate, CALCIUM ION, Concanavalin-A, ... | | Authors: | Sakai, F, Weiss, M.S, Chen, G. | | Deposit date: | 2014-04-06 | | Release date: | 2014-08-27 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Structure of ConA/Rh4Man
To Be Published
|
|
1NR7
 | | Crystal structure of apo bovine glutamate dehydrogenase | | Descriptor: | Glutamate dehydrogenase 1 | | Authors: | Banerjee, S, Schmidt, T, Fang, J, Stanley, C.A, Smith, T.J. | | Deposit date: | 2003-01-23 | | Release date: | 2003-05-06 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Structural studies on ADP activation of mammalian glutamate dehydrogenase and the evolution of regulation
Biochemistry, 42, 2003
|
|
4PA8
 | | Crystal structure of a de novo retro-aldolase catalyzing asymmetric Michael additions, with a covalently bound product analog | | Descriptor: | (3R)-3-(4-methoxyphenyl)-5-oxohexanenitrile, GLYCEROL, SULFATE ION, ... | | Authors: | Beck, T, Garrabou Pi, X, Hilvert, D. | | Deposit date: | 2014-04-07 | | Release date: | 2015-04-01 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.2 Å) | | Cite: | A Promiscuous De Novo Retro-Aldolase Catalyzes Asymmetric Michael Additions via Schiff Base Intermediates.
Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
1NSG
 | | THE STRUCTURE OF THE IMMUNOPHILIN-IMMUNOSUPPRESSANT FKBP12-RAPAMYCIN COMPLEX INTERACTING WITH HUMAN FRAP | | Descriptor: | C49-METHYL RAPAMYCIN, FK506-BINDING PROTEIN, FKBP-RAPAMYCIN ASSOCIATED PROTEIN (FRAP) | | Authors: | Liang, J, Choi, J, Clardy, J. | | Deposit date: | 1997-07-01 | | Release date: | 1998-03-18 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Refined structure of the FKBP12-rapamycin-FRB ternary complex at 2.2 A resolution.
Acta Crystallogr.,Sect.D, 55, 1999
|
|
4P82
 | | Structure of PyrR protein from Bacillus subtilis | | Descriptor: | Bifunctional protein PyrR, SULFATE ION | | Authors: | Perica, T, Kondo, Y, Tiwari, S, McLaughlin, S, Steward, A, Reuter, N, Clarke, J, Teichmann, S.A. | | Deposit date: | 2014-03-30 | | Release date: | 2014-12-17 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Evolution of oligomeric state through allosteric pathways that mimic ligand binding.
Science, 346, 2014
|
|
1NU1
 | | Crystal Structure of Mitochondrial Cytochrome bc1 Complexed with 2-nonyl-4-hydroxyquinoline N-oxide (NQNO) | | Descriptor: | 2-NONYL-4-HYDROXYQUINOLINE N-OXIDE, Cytochrome b, FE2/S2 (INORGANIC) CLUSTER, ... | | Authors: | Gao, X, Wen, X, Esser, L, Quinn, B, Yu, L, Yu, C.-A, Xia, D. | | Deposit date: | 2003-01-30 | | Release date: | 2003-10-07 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the quinone reduction in the bc(1) complex: a comparative analysis of crystal structures of mitochondrial cytochrome bc(1) with bound substrate and inhibitors at the Q(i) site
Biochemistry, 42, 2003
|
|
4PAO
 | | A conserved phenylalanine as relay between the 5 helix and the GDP binding region of heterotrimeric G protein | | Descriptor: | 5'-GUANOSINE-DIPHOSPHATE-MONOTHIOPHOSPHATE, Guanine nucleotide-binding protein G(i) subunit alpha-1, MAGNESIUM ION | | Authors: | Kaya, A.I, Lokits, A.D, Gilbert, J, Iverson, T.M, Meiler, J, Hamm, H.E. | | Deposit date: | 2014-04-09 | | Release date: | 2014-07-30 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.003 Å) | | Cite: | A Conserved Phenylalanine as a Relay between the alpha 5 Helix and the GDP Binding Region of Heterotrimeric Gi Protein alpha Subunit.
J.Biol.Chem., 289, 2014
|
|
1NPX
 | | STRUCTURE OF NADH PEROXIDASE FROM STREPTOCOCCUS FAECALIS 10C1 REFINED AT 2.16 ANGSTROMS RESOLUTION | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, NADH PEROXIDASE | | Authors: | Stehle, T, Ahmed, S.A, Claiborne, A, Schulz, G.E. | | Deposit date: | 1991-08-02 | | Release date: | 1994-01-31 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (2.16 Å) | | Cite: | Structure of NADH peroxidase from Streptococcus faecalis 10C1 refined at 2.16 A resolution.
J.Mol.Biol., 221, 1991
|
|
1OAP
 | | Mad structure of the periplasmique domain of the Escherichia coli PAL protein | | Descriptor: | PEPTIDOGLYCAN-ASSOCIATED LIPOPROTEIN, SULFATE ION | | Authors: | Abergel, C, Walburger, A, Bouveret, E, Claverie, J.M. | | Deposit date: | 2003-01-20 | | Release date: | 2004-02-13 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.93 Å) | | Cite: | Crystallization and preliminary crystallographic study of the peptidoglycan-associated lipoprotein from Escherichia coli.
Acta Crystallogr.,Sect.D, 57, 2001
|
|
