2N72
 
 | | Solution structure of the Q domain from ACBD3 | | Descriptor: | Golgi resident protein GCP60 | | Authors: | Veverka, V, Hexnerova, R. | | Deposit date: | 2015-09-02 | | Release date: | 2016-07-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structural insights and in vitro reconstitution of membrane targeting and activation of human PI4KB by the ACBD3 protein.
Sci Rep, 6, 2016
|
|
2N73
 | | Solution structure of the ACBD3:PI4KB complex | | Descriptor: | Golgi resident protein GCP60, Phosphatidylinositol 4-kinase beta | | Authors: | Veverka, V, Hexnerova, R. | | Deposit date: | 2015-09-02 | | Release date: | 2016-07-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Structural insights and in vitro reconstitution of membrane targeting and activation of human PI4KB by the ACBD3 protein.
Sci Rep, 6, 2016
|
|
1C04
 | | IDENTIFICATION OF KNOWN PROTEIN AND RNA STRUCTURES IN A 5 A MAP OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI | | Descriptor: | 23S RRNA FRAGMENT, RIBOSOMAL PROTEIN L11, RIBOSOMAL PROTEIN L14, ... | | Authors: | Ban, N, Nissen, P, Capel, M, Moore, P.B, Steitz, T.A. | | Deposit date: | 1999-07-14 | | Release date: | 1999-08-31 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (5 Å) | | Cite: | Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit.
Nature, 400, 1999
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
