1FFK
| CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-25 | Release date: | 2000-08-14 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science, 289, 2000
|
|
6G5H
| Cryo-EM structure of a late human pre-40S ribosomal subunit - Mature | Descriptor: | 18S ribosomal RNA, 40S ribosomal protein S10, 40S ribosomal protein S11, ... | Authors: | Ameismeier, M, Cheng, J, Berninghausen, O, Beckmann, R. | Deposit date: | 2018-03-29 | Release date: | 2018-06-06 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Visualizing late states of human 40S ribosomal subunit maturation. Nature, 558, 2018
|
|
1PN7
| Coordinates of S12, L11 proteins and P-tRNA, from the 70S X-ray structure aligned to the 70S Cryo-EM map of E.coli ribosome | Descriptor: | 30S ribosomal protein S12, 50S ribosomal protein L11, P-tRNA | Authors: | Valle, M, Zavialov, A, Sengupta, J, Rawat, U, Ehrenberg, M, Frank, J. | Deposit date: | 2003-06-12 | Release date: | 2003-07-15 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (10.8 Å) | Cite: | Locking and Unlocking of Ribosomal Motions Cell(Cambridge,Mass.), 114, 2003
|
|
5CSO
| Structure of the complex of type 1 ribosome inactivating protein from Momordica balsamina with a nucleoside, cytidine at 1.78 A resolution | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 4-AMINO-1-BETA-D-RIBOFURANOSYL-2(1H)-PYRIMIDINONE, GLYCEROL, ... | Authors: | Yamin, S, Pandey, S, Kaur, P, Sharma, S, Singh, T.P. | Deposit date: | 2015-07-23 | Release date: | 2015-08-12 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.78 Å) | Cite: | Binding and structural studies of the complexes of type 1 ribosome inactivating protein fromMomordica balsaminawith cytosine, cytidine, and cytidine diphosphate. Biochem Biophys Rep, 4, 2015
|
|
5CST
| Structure of the complex of type 1 ribosome inactivating protein from Momordica balsamina with a nucleotide, cytidine diphosphate at 1.78 A resolution | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CYTIDINE-5'-DIPHOSPHATE, GLYCEROL, ... | Authors: | Yamin, S, Pandey, S, Kaur, P, Sharma, S, Singh, T.P. | Deposit date: | 2015-07-23 | Release date: | 2015-08-12 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.78 Å) | Cite: | Binding and structural studies of the complexes of type 1 ribosome inactivating protein fromMomordica balsaminawith cytosine, cytidine, and cytidine diphosphate. Biochem Biophys Rep, 4, 2015
|
|
1Z58
| Crystal structure of a complex of the ribosome large subunit with rapamycin | Descriptor: | 23S RIBOSOMAL RNA, RAPAMYCIN IMMUNOSUPPRESSANT DRUG | Authors: | Amit, M, Berisio, R, Baram, D, Harms, J, Bashan, A, Yonath, A. | Deposit date: | 2005-03-17 | Release date: | 2005-06-28 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | A crevice adjoining the ribosome tunnel: Hints for cotranslational folding. Febs Lett., 579, 2005
|
|
1K8A
| Co-crystal structure of Carbomycin A bound to the 50S ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | Authors: | Hansen, J.L, Ippolito, J.A, Ban, N, Nissen, P, Moore, P.B, Steitz, T. | Deposit date: | 2001-10-23 | Release date: | 2002-07-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol.Cell, 10, 2002
|
|
1N33
| Structure of the Thermus thermophilus 30S ribosomal subunit bound to codon and near-cognate transfer rna anticodon stem-loop mismatched at the second codon position at the a site with paromomycin | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Ogle, J.M, Murphy IV, F.V, Tarry, M.J, Ramakrishnan, V. | Deposit date: | 2002-10-25 | Release date: | 2002-11-29 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (3.35 Å) | Cite: | Selection of tRNA by the Ribosome Requires a Transition from an Open to a Closed Form Cell(Cambridge,Mass.), 111, 2002
|
|
1N36
| Structure of the Thermus thermophilus 30S ribosomal subunit in the presence of crystallographically disordered codon and near-cognate transfer RNA anticodon stem-loop mismatched at the second codon position | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Ogle, J.M, Murphy IV, F.V, Tarry, M.J, Ramakrishnan, V. | Deposit date: | 2002-10-25 | Release date: | 2002-11-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.65 Å) | Cite: | Selection of tRNA by the Ribosome Requires a Transition from an Open to a Closed Form Cell(Cambridge,Mass.), 111, 2002
|
|
5HKV
| The crystal structure of the large ribosomal subunit of Staphylococcus aureus in complex with lincomycin | Descriptor: | (4S)-2-METHYL-2,4-PENTANEDIOL, 23s ribosomal RNA, 50S ribosomal protein L13, ... | Authors: | Yonath, A, Matzov, D, Eyal, Z, Ben Hamou, R, Zimmerman, E, Rozenberg, H, Bashan, A, Fridman, M. | Deposit date: | 2016-01-14 | Release date: | 2017-05-03 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.66 Å) | Cite: | Structural insights of lincosamides targeting the ribosome of Staphylococcus aureus. Nucleic Acids Res., 45, 2017
|
|
1N34
| Structure of the Thermus thermophilus 30S ribosomal subunit in the presence of codon and crystallographically disordered near-cognate transfer rna anticodon stem-loop mismatched at the first codon position | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Ogle, J.M, Murphy IV, F.V, Tarry, M.J, Ramakrishnan, V. | Deposit date: | 2002-10-25 | Release date: | 2002-11-29 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | Selection of tRNA by the Ribosome Requires a Transition from an Open to a Closed Form Cell(Cambridge,Mass.), 111, 2002
|
|
1J5E
| Structure of the Thermus thermophilus 30S Ribosomal Subunit | Descriptor: | 16S ribosomal RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Wimberly, B.T, Brodersen, D.E, Clemons Jr, W.M, Morgan-Warren, R, Carter, A.P, Vonrhein, C, Hartsch, T, Ramakrishnan, V. | Deposit date: | 2002-04-08 | Release date: | 2002-04-12 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (3.05 Å) | Cite: | Structure of the 30S ribosomal subunit. Nature, 407, 2000
|
|
1N32
| Structure of the Thermus thermophilus 30S ribosomal subunit bound to codon and near-cognate transfer RNA anticodon stem-loop mismatched at the first codon position at the a site with paromomycin | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S10, 30S RIBOSOMAL PROTEIN S11, ... | Authors: | Ogle, J.M, Murphy IV, F.V, Tarry, M.J, Ramakrishnan, V. | Deposit date: | 2002-10-25 | Release date: | 2002-11-29 | Last modified: | 2019-11-20 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Selection of tRNA by the Ribosome Requires a Transition from an Open to a Closed Form Cell(Cambridge,Mass.), 111, 2002
|
|
6HMA
| Improved model derived from cryo-EM map of Staphylococcus aureus large ribosomal subunit | Descriptor: | 23S ribosomal RNA, 50S ribosomal protein L13, 50S ribosomal protein L14, ... | Authors: | Eyal, Z, Cimicata, G, Matzov, D, Fox, T, de Val, N, Zimmerman, E, Bashan, A, Yonath, A. | Deposit date: | 2018-09-12 | Release date: | 2018-11-14 | Last modified: | 2020-05-27 | Method: | ELECTRON MICROSCOPY (2.65 Å) | Cite: | Improved model derived from cryo-EM map of Staphylococcus aureus large ribosomal subunit To Be Published
|
|
6NQB
| |
8BH7
| The complex of immature 30S ribosomal subunit with Ribosome maturation factor P (RimP) from Staphylococcus aureus | Descriptor: | 16S ribosomal RNA, 30S ribosomal protein S10, 30S ribosomal protein S11, ... | Authors: | Garaeva, N, Fatkhullin, B, Jenner, L, Soufari, H, Yusupov, M, Usachev, K. | Deposit date: | 2022-10-30 | Release date: | 2023-09-20 | Last modified: | 2023-11-08 | Method: | ELECTRON MICROSCOPY (4.23 Å) | Cite: | Ribosome maturation factor P (RimP) from Staphylococcus aureus Structure, 2023
|
|
1EMW
| SOLUTION STRUCTURE OF THE RIBOSOMAL PROTEIN S16 FROM THERMUS THERMOPHILUS | Descriptor: | S16 RIBOSOMAL PROTEIN | Authors: | Allard, P, Rak, A.V, Wimberly, B.T, Clemons Jr, W.M, Kalinin, A, Helgstrand, M, Garber, M.B, Ramakrishnan, V, Hard, T. | Deposit date: | 2000-03-20 | Release date: | 2000-08-09 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Another piece of the ribosome: solution structure of S16 and its location in the 30S subunit. Structure Fold.Des., 8, 2000
|
|
1G1X
| STRUCTURE OF RIBOSOMAL PROTEINS S15, S6, S18, AND 16S RIBOSOMAL RNA | Descriptor: | 16S RIBOSOMAL RNA, 30S RIBOSOMAL PROTEIN S15, 30S RIBOSOMAL PROTEIN S18, ... | Authors: | Agalarov, S.C, Prasad, G.S, Funke, P.M, Stout, C.D, Williamson, J.R. | Deposit date: | 2000-10-13 | Release date: | 2000-10-30 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Structure of the S15,S6,S18-rRNA complex: assembly of the 30S ribosome central domain. Science, 288, 2000
|
|
3BNR
| |
2BCW
| Coordinates of the N-terminal domain of ribosomal protein L11,C-terminal domain of ribosomal protein L7/L12 and a portion of the G' domain of elongation factor G, as fitted into cryo-em map of an Escherichia coli 70S*EF-G*GDP*fusidic acid complex | Descriptor: | 50S ribosomal protein L11, 50S ribosomal protein L7/L12, Elongation factor G | Authors: | Datta, P.P, Sharma, M.R, Qi, L, Frank, J, Agrawal, R.K. | Deposit date: | 2005-10-19 | Release date: | 2005-12-20 | Last modified: | 2024-02-14 | Method: | ELECTRON MICROSCOPY (11.2 Å) | Cite: | Interaction of the G' Domain of Elongation Factor G and the C-Terminal Domain of Ribosomal Protein L7/L12 during Translocation as Revealed by Cryo-EM. Mol.Cell, 20, 2005
|
|
1FFZ
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1FG0
| LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | Deposit date: | 2000-07-26 | Release date: | 2000-08-28 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | The structural basis of ribosome activity in peptide bond synthesis. Science, 289, 2000
|
|
1QVG
| Structure of CCA oligonucleotide bound to the tRNA binding sites of the large ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | Deposit date: | 2003-08-27 | Release date: | 2003-11-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit RNA, 9, 2003
|
|
1QVF
| Structure of a deacylated tRNA minihelix bound to the E site of the large ribosomal subunit of Haloarcula marismortui | Descriptor: | 23S ribosomal rna, 50S RIBOSOMAL PROTEIN L10E, 50S ribosomal protein L13P, ... | Authors: | Schmeing, T.M, Moore, P.B, Steitz, T.A. | Deposit date: | 2003-08-27 | Release date: | 2003-11-11 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.1 Å) | Cite: | Structures of deacylated tRNA mimics bound to the E site of the large ribosomal subunit RNA, 9, 2003
|
|
8GHU
| |