1SAX
 
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
4RV1
 | | Crystal Structure of Engineered Protein. Northeast Structural Genomics Consortium (NESG) Target OR497. | | Descriptor: | ACETATE ION, Engineered Protein OR497 | | Authors: | Vorobiev, S, Parmeggiani, F, Seetharaman, J, Xiao, R, Everett, J.K, Acton, T.B, Baker, D, Montelione, G.T, Tong, L, Hunt, J.F, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2014-11-24 | | Release date: | 2014-12-10 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.573 Å) | | Cite: | Crystal Structure of Engineered Protein OR497.
To be Published
|
|
3TY2
 | | Structure of a 5'-nucleotidase (surE) from Coxiella burnetii | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-nucleotidase surE | | Authors: | Cheung, J, Franklin, M.C, Rudolph, M, Cassidy, M, Gary, E, Burshteyn, F, Love, J. | | Deposit date: | 2011-09-23 | | Release date: | 2011-10-19 | | Last modified: | 2023-12-06 | | Method: | X-RAY DIFFRACTION (1.885 Å) | | Cite: | Structural genomics for drug design against the pathogen Coxiella burnetii.
Proteins, 83, 2015
|
|
5D46
 | | Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination | | Descriptor: | ACETATE ION, DNA (5'-D(*AP*AP*AP*AP*AP*A)-3'), DNA (5'-D(*TP*TP*TP*TP*TP*GP*C)-3'), ... | | Authors: | Loc'h, J, Rosario, S, Delarue, M. | | Deposit date: | 2015-08-07 | | Release date: | 2016-07-27 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination.
Structure, 24, 2016
|
|
5D4N
 | | Structure of CPII bound to ADP, AMP and acetate, from Thiomonas intermedia K12 | | Descriptor: | ACETATE ION, ADENOSINE MONOPHOSPHATE, ADENOSINE-5'-DIPHOSPHATE, ... | | Authors: | Wheatley, N.M, Ngo, J, Cascio, D, Sawaya, M.R, Yeates, T.O. | | Deposit date: | 2015-08-08 | | Release date: | 2016-09-28 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | A PII-Like Protein Regulated by Bicarbonate: Structural and Biochemical Studies of the Carboxysome-Associated CPII Protein.
J.Mol.Biol., 428, 2016
|
|
7M4T
 | | Menin bound to M-1121 | | Descriptor: | Menin, methyl {(1S,2R)-2-[(1S)-2-(azetidin-1-yl)-1-(3-fluorophenyl)-1-{1-[(3-methoxy-1-{4-[(1S,4S)-5-propanoyl-2,5-diazabicyclo[2.2.1]heptane-2-sulfonyl]phenyl}azetidin-3-yl)methyl]piperidin-4-yl}ethyl]cyclopentyl}carbamate, praseodymium triacetate | | Authors: | Stuckey, J. | | Deposit date: | 2021-03-22 | | Release date: | 2021-08-11 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.74 Å) | | Cite: | Discovery of M-1121 as an Orally Active Covalent Inhibitor of Menin-MLL Interaction Capable of Achieving Complete and Long-Lasting Tumor Regression.
J.Med.Chem., 64, 2021
|
|
3ZTF
 | | X-ray Structure of the Cyan Fluorescent Protein mTurquoise2 (K206A mutant) | | Descriptor: | GREEN FLUORESCENT PROTEIN | | Authors: | von Stetten, D, Goedhart, J, Noirclerc-Savoye, M, Lelimousin, M, Joosen, L, Hink, M.A, van Weeren, L, Gadella, T.W.J, Royant, A. | | Deposit date: | 2011-07-07 | | Release date: | 2012-03-21 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (1.31 Å) | | Cite: | Structure-Guided Evolution of Cyan Fluorescent Proteins Towards a Quantum Yield of 93%
Nat.Commun, 3, 2012
|
|
5D6O
 | | Orthorhombic Crystal Structure of an acetylester hydrolase from Corynebacterium glutamicum | | Descriptor: | CHLORIDE ION, GLYCEROL, Homoserine O-acetyltransferase, ... | | Authors: | Niefind, K, Toelzer, C, Altenbuchner, J, Watzlawick, H. | | Deposit date: | 2015-08-12 | | Release date: | 2015-12-09 | | Last modified: | 2024-05-01 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | A novel esterase subfamily with alpha / beta-hydrolase fold suggested by structures of two bacterial enzymes homologous to l-homoserine O-acetyl transferases.
Febs Lett., 590, 2016
|
|
4S17
 | | The crystal structure of glutamine synthetase from Bifidobacterium adolescentis ATCC 15703 | | Descriptor: | ACETATE ION, Glutamine synthetase, MAGNESIUM ION | | Authors: | Cuff, M, Tan, K, Mack, J, Clancy, S, Joachimiak, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2015-01-08 | | Release date: | 2015-01-28 | | Last modified: | 2017-11-22 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | The crystal structure of glutamine synthetase from Bifidobacterium adolescentis ATCC 15703
To be Published
|
|
1SA9
 | | Crystal Structure of the RNA octamer GGCGAGCC | | Descriptor: | 5'-R(*GP*GP*CP*GP*AP*GP*CP*C)-3' | | Authors: | Jang, S.B, Baeyens, K, Jeong, M.S, SantaLucia Jr, J, Turner, D, Holbrook, S.R. | | Deposit date: | 2004-02-09 | | Release date: | 2004-05-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.86 Å) | | Cite: | Structures of two RNA octamers containing tandem G.A base pairs.
Acta Crystallogr.,Sect.D, 60, 2004
|
|
5CUA
 | | Crystal structure of the bromodomain of bromodomain adjacent to zinc finger domain protein 2B (BAZ2B) in complex with 1-Acetyl-4-(4-hydroxyphenyl)piperazine (SGC - Diamond I04-1 fragment screening) | | Descriptor: | 1,2-ETHANEDIOL, 1-[4-(4-hydroxyphenyl)piperazin-1-yl]ethanone, Bromodomain adjacent to zinc finger domain protein 2B | | Authors: | Bradley, A, Pearce, N, Krojer, T, Ng, J, Talon, R, Vollmar, M, Jose, B, von Delft, F, Bountra, C, Arrowsmith, C.H, Edwards, A, Knapp, S, Structural Genomics Consortium (SGC) | | Deposit date: | 2015-07-24 | | Release date: | 2015-09-09 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.89 Å) | | Cite: | Crystal structure of the second bromodomain of bromodomain adjancent to zinc finger domain protein 2B (BAZ2B) in complex with 1-Acetyl-4-(4-hydroxyphenyl)piperazine (SGC - Diamond I04-1 fragment screening)
To be published
|
|
4RLI
 | | Crystal structure of human dihydroorotate dehydrogenase (DHODH) with DH03A048 | | Descriptor: | Dihydroorotate dehydrogenase (quinone), mitochondrial, FLAVIN MONONUCLEOTIDE, ... | | Authors: | Zhu, L, Ren, X, Zhu, J, Li, H. | | Deposit date: | 2014-10-17 | | Release date: | 2015-11-04 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal structure of human dihydroorotate dehydrogenase (DHODH) with DH03A048
TO BE PUBLISHED
|
|
1SG3
 | | Structure of allantoicase | | Descriptor: | Allantoicase | | Authors: | Leulliot, N, Quevillon-Cheruel, S, Sorel, I, Graille, M, Meyer, P, Liger, D, Blondeau, K, Janin, J, van Tilbeurgh, H. | | Deposit date: | 2004-02-23 | | Release date: | 2004-03-02 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal Structure of Yeast Allantoicase Reveals a Repeated Jelly Roll Motif
J.Biol.Chem., 279, 2004
|
|
1RH8
 | | Three-dimensional structure of the calcium-free Piccolo C2A-domain | | Descriptor: | Piccolo protein | | Authors: | Garcia, J, Gerber, S.H, Sugita, S, Sudhof, T.C, Rizo, J. | | Deposit date: | 2003-11-14 | | Release date: | 2004-01-13 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | A conformational switch in the Piccolo C2A domain regulated by alternative splicing.
Nat.Struct.Mol.Biol., 11, 2004
|
|
4TKF
 | | Crystal Structure of human Tankyrase 2 in complex with IWR-1. | | Descriptor: | 3-aminobenzamide, 4-[(3aR,4R,7S,7aS)-1,3-dioxooctahydro-2H-4,7-methanoisoindol-2-yl]-N-(quinolin-8-yl)benzamide, Tankyrase-2, ... | | Authors: | Qiu, W, Lam, R, Romanov, V, Gordon, R, Gebremeskel, S, Vodsedalek, J, Thompson, C, Beletskaya, I, Battaile, K.P, Pai, E.F, Chirgadze, N.Y. | | Deposit date: | 2014-05-26 | | Release date: | 2014-11-05 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Insights into the binding of PARP inhibitors to the catalytic domain of human tankyrase-2.
Acta Crystallogr.,Sect.D, 70, 2014
|
|
5DA5
 | | Crystal structure of Rhodospirillum rubrum Rru_A0973 | | Descriptor: | CALCIUM ION, FE (III) ION, GLYCOLIC ACID, ... | | Authors: | He, D, Vanden Hehier, S, Georgiev, A, Altenbach, K, Tarrant, E, Mackay, C.L, Waldron, K.J, Clarke, D.J, Marles-Wright, J. | | Deposit date: | 2015-08-19 | | Release date: | 2016-08-10 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.064 Å) | | Cite: | Structural characterization of encapsulated ferritin provides insight into iron storage in bacterial nanocompartments.
Elife, 5, 2016
|
|
4F3R
 | | Structure of phosphopantetheine adenylyltransferase (CBU_0288) from Coxiella burnetii | | Descriptor: | CALCIUM ION, Phosphopantetheine adenylyltransferase | | Authors: | Franklin, M.C, Cheung, J, Rudolph, M, Cassidy, M, Gary, E, Burshteyn, F, Love, J. | | Deposit date: | 2012-05-09 | | Release date: | 2012-07-04 | | Last modified: | 2016-02-10 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | Structural genomics for drug design against the pathogen Coxiella burnetii.
Proteins, 83, 2015
|
|
3U92
 | |
5D4B
 | | Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination | | Descriptor: | DNA (5'-D(*AP*AP*AP*AP*AP*C)-3'), DNA (5'-D(*TP*TP*TP*TP*TP*GP*G)-3'), MAGNESIUM ION, ... | | Authors: | Loc'h, J, Rosario, S, Delarue, M. | | Deposit date: | 2015-08-07 | | Release date: | 2016-07-27 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.66 Å) | | Cite: | Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination.
Structure, 24, 2016
|
|
5D51
 | | Krypton derivatization of an O2-tolerant membrane-bound [NiFe] hydrogenase reveals a hydrophobic gas tunnel network | | Descriptor: | CHLORIDE ION, FE3-S4 CLUSTER, FE4-S3 CLUSTER, ... | | Authors: | Kalms, J, Schmidt, A, Frielingsdorf, S, van der Linden, P, von Stetten, D, Lenz, O, Carpentier, P, Scheerer, P. | | Deposit date: | 2015-08-10 | | Release date: | 2016-03-23 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (1.47 Å) | | Cite: | Krypton Derivatization of an O2 -Tolerant Membrane-Bound [NiFe] Hydrogenase Reveals a Hydrophobic Tunnel Network for Gas Transport.
Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
4RYE
 | | The crystal structure of D-ALANYL-D-ALANINE CARBOXYPEPTIDASE from Mycobacterium tuberculosis H37Rv | | Descriptor: | D-alanyl-D-alanine carboxypeptidase | | Authors: | Cuff, M, Tan, K, Hatzos-Skintges, C, Jedrzejczak, R, Sacchettini, J, Joachimiak, A, Midwest Center for Structural Genomics (MCSG), Structures of Mtb Proteins Conferring Susceptibility to Known Mtb Inhibitors (MTBI) | | Deposit date: | 2014-12-15 | | Release date: | 2015-01-28 | | Last modified: | 2017-11-22 | | Method: | X-RAY DIFFRACTION (1.901 Å) | | Cite: | The crystal structure of D-ALANYL-D-ALANINE CARBOXYPEPTIDASE from Mycobacterium tuberculosis H37Rv
To be Published
|
|
4RYV
 | | Crystal structure of yellow lupin LLPR-10.1A protein in complex with trans-zeatin | | Descriptor: | (2E)-2-methyl-4-(9H-purin-6-ylamino)but-2-en-1-ol, Protein LLPR-10.1A, SULFATE ION | | Authors: | Dolot, R, Michalska, K, Sliwiak, J, Bujacz, G, Sikorski, M.M, Jaskolski, M. | | Deposit date: | 2014-12-17 | | Release date: | 2015-12-09 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.38 Å) | | Cite: | Crystallographic and CD probing of ligand-induced conformational changes in a plant PR-10 protein.
J.Struct.Biol., 193, 2016
|
|
1S6R
 | | 908R class c beta-lactamase bound to iodo-acetamido-phenyl boronic acid | | Descriptor: | 4-IODO-ACETAMIDO PHENYLBORONIC ACID, beta-lactamase | | Authors: | Wouters, J. | | Deposit date: | 2004-01-27 | | Release date: | 2004-02-24 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.24 Å) | | Cite: | Crystal structure of Enterobacter cloacae 908R class C beta-lactamase bound to iodo-acetamido-phenyl boronic acid, a transition-state analogue.
Cell.Mol.Life Sci., 60, 2003
|
|
4S1L
 | | Structure of Uranotaenia sapphirina cypovirus (CPV17) polyhedrin at 298 K | | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, polyhedrin | | Authors: | Ginn, H.M, Messerschmidt, M, Ji, X, Zhang, H, Axford, D, Gildea, R.J, Winter, G, Brewster, A.S, Hattne, J, Wagner, A, Grimes, J.M, Evans, G, Sauter, N.K, Sutton, G, Stuart, D.I. | | Deposit date: | 2015-01-14 | | Release date: | 2015-03-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.752 Å) | | Cite: | Structure of CPV17 polyhedrin determined by the improved analysis of serial femtosecond crystallographic data.
Nat Commun, 6, 2015
|
|
3ZSY
 | | Small molecule inhibitors of the LEDGF site of HIV type 1 integrase identified by fragment screening and structure based drug design | | Descriptor: | (R)-(4-CARBOXY-1,3-BENZODIOXOL-5-YL)METHYL-[[2-(CYCLOHEXYLMETHYLCARBAMOYL)PHENYL]METHYL]-METHYL-AZANIUM, ACETATE ION, INTEGRASE, ... | | Authors: | Peat, T.S, Newman, J, Rhodes, D.I, Vandergraaff, N, Le, G, Jones, E.D, Smith, J.A, Coates, J.A.V, Thienthong, N, Dolezal, O, Ryan, J.H, Savage, G.P, Francis, C.L, Deadman, J.J. | | Deposit date: | 2011-07-01 | | Release date: | 2012-07-11 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Small Molecule Inhibitors of the Ledgf Site of Human Immunodeficiency Virus Integrase Identified by Fragment Screening and Structure Based Design.
Plos One, 7, 2012
|
|
