5E3M

Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Summary for 5E3M

• Entry DOI: 10.2210/pdb5e3m/pdb
• Related: 5E3L 5E3N 5E3O
• Descriptor: DNA-binding protein Fis, DNA (27-MER), ... (4 entities in total)
• Functional Keywords: protein-dna complex, hth domain, minor groove compression, dna bending, indirect recognition, dna binding protein-dna complex, dna binding protein/dna
• Biological source: Escherichia coli; More
• Total number of polymer chains: 4
• Total formula weight: 39092.63

Authors

Stella, S.,Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2015-10-03, release date: 2016-03-09, Last modification date: 2022-03-23)

• Primary citation: Hancock, S.P.,Stella, S.,Cascio, D.,Johnson, R.C.; DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.; Plos One, 11:e0150189-e0150189, 2016; PubMed: 26959646; DOI: 10.1371/journal.pone.0150189

Experimental method

X-RAY DIFFRACTION (2.886 Å)