8P53
| |
7VBS
| |
7VBW
| |
6M10
| Crystal structure of PA4853 (Fis) from Pseudomonas aeruginosa | Descriptor: | Putative Fis-like DNA-binding protein | Authors: | Zhang, H, Gao, Z, Zhou, J, Dong, Y. | Deposit date: | 2020-02-24 | Release date: | 2020-05-13 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.985 Å) | Cite: | Crystal structure of the nucleoid-associated protein Fis (PA4853) from Pseudomonas aeruginosa. Acta Crystallogr.,Sect.F, 76, 2020
|
|
6P0U
| Crystal structure of ternary DNA complex " FX(1-2)-2Xis" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
6P0S
| Crystal structure of ternary DNA complex "FX2" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
6P0T
| Crystal structure of ternary DNA complex "FX(1-2)-1Xis" containing E. coli Fis and phage lambda Xis | Descriptor: | DNA (27-MER), FX1-2, DNA-binding protein Fis, ... | Authors: | Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2019-05-17 | Release date: | 2019-06-19 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (3.603 Å) | Cite: | Cooperative DNA binding by proteins through DNA shape complementarity. Nucleic Acids Res., 47, 2019
|
|
5M7O
| Crystal structure of NtrX from Brucella abortus processed with the CrystalDirect automated mounting and cryo-cooling technology | Descriptor: | MAGNESIUM ION, Nitrogen assimilation regulatory protein | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | Deposit date: | 2016-10-28 | Release date: | 2017-01-25 | Last modified: | 2017-04-26 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators. J. Mol. Biol., 429, 2017
|
|
5M7N
| Crystal structure of NtrX from Brucella abortus in complex with ATP processed with the CrystalDirect automated mounting and cryo-cooling technology | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, Nitrogen assimilation regulatory protein | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | Deposit date: | 2016-10-28 | Release date: | 2017-01-25 | Last modified: | 2017-04-26 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators. J. Mol. Biol., 429, 2017
|
|
5M7P
| Crystal structure of NtrX from Brucella abortus in complex with ADP processed with the CrystalDirect automated mounting and cryo-cooling technology | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, Nitrogen assimilation regulatory protein | Authors: | Cornaciu, I, Fernandez, I, Hoffmann, G, Carrica, M.C, Goldbaum, F.A, Marquez, J.A. | Deposit date: | 2016-10-28 | Release date: | 2017-01-25 | Last modified: | 2017-04-26 | Method: | X-RAY DIFFRACTION (2.36 Å) | Cite: | Three-Dimensional Structure of Full-Length NtrX, an Unusual Member of the NtrC Family of Response Regulators. J. Mol. Biol., 429, 2017
|
|
5EXX
| AAA+ ATPase FleQ from Pseudomonas aeruginosa bound to c-di-GMP | Descriptor: | 9,9'-[(2R,3R,3aS,5S,7aR,9R,10R,10aS,12S,14aR)-3,5,10,12-tetrahydroxy-5,12-dioxidooctahydro-2H,7H-difuro[3,2-d:3',2'-j][1,3,7,9,2,8]tetraoxadiphosphacyclododecine-2,9-diyl]bis(2-amino-1,9-dihydro-6H-purin-6-one), SULFATE ION, Transcriptional regulator FleQ | Authors: | Navarro, M.V.A.S, Sondermann, H, Krasteva, P.V. | Deposit date: | 2015-11-24 | Release date: | 2016-02-10 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (3.311 Å) | Cite: | Mechanistic insights into c-di-GMP-dependent control of the biofilm regulator FleQ from Pseudomonas aeruginosa. Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
5E3L
| |
5E3O
| |
5E3N
| |
5E3M
| Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2022-03-23 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
5DTD
| |
5DS9
| |
4L5E
| Crystal structure of A. aeolicus NtrC1 DNA binding domain | Descriptor: | SULFATE ION, Transcriptional regulator (NtrC family) | Authors: | Young, A, Maris, A.E, Vidangos, N.K, Hong, E, Pelton, J.G, Batchelor, J.D, Wemmer, D.E. | Deposit date: | 2013-06-10 | Release date: | 2013-08-28 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.34 Å) | Cite: | Structure, function, and tethering of DNA-binding domains in sigma (54) transcriptional activators. Biopolymers, 99, 2013
|
|
4L4U
| Crystal structure of construct containing A. aeolicus NtrC1 receiver, central and DNA binding domains | Descriptor: | Transcriptional regulator (NtrC family) | Authors: | Vidangos, N.K, Maris, A.E, Young, A, Hong, E, Pelton, J.G, Batchelor, J.D, Wemmer, D.E. | Deposit date: | 2013-06-09 | Release date: | 2013-08-28 | Last modified: | 2013-10-23 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structure, function, and tethering of DNA-binding domains in sigma (54) transcriptional activators. Biopolymers, 99, 2013
|
|
2M8G
| |
4FTH
| Crystal Structure of NtrC4 DNA-binding domain bound to double-stranded DNA | Descriptor: | 5'-D(*AP*CP*TP*TP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*AP*AP*AP*TP*GP*CP*AP*T)-3', 5'-D(P*GP*AP*TP*GP*CP*AP*TP*TP*TP*GP*CP*AP*AP*AP*TP*TP*TP*GP*CP*AP*A)-3', Transcriptional regulator (NtrC family) | Authors: | Vidangos, N.K, Heideker, J, Lyubimov, A.Y, Lamers, M, Huo, Y, Pelton, J.G, Ton, J, Gralla, J.D, Kuriyan, J, Berger, J.M, Wemmer, D.E. | Deposit date: | 2012-06-27 | Release date: | 2012-08-29 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (3.004 Å) | Cite: | DNA Recognition by a sigma (54) Transcriptional Activator from Aquifex aeolicus. J.Mol.Biol., 426, 2014
|
|
3RQI
| |
3JR9
| |
3JRF
| |
3JRD
| |