1Q9C
  • Download 1q9c
  • View 1q9c
Molmil generated image of 1q9c
CRYSTAL STRUCTURE OF THE HISTONE DOMAIN OF SON OF SEVENLESS
Descriptor:Son of sevenless protein
Authors:Sondermann, H., Soisson, S.M., Bar-Sagi, D., Kuriyan, J.
Deposit date:2003-08-24
Release date:2003-12-09
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.21 Å)
Cite:Tandem Histone Folds in the Structure of the N-terminal Segment of the Ras Activator Son of Sevenless
Structure, 11, 2003
1EQZ
  • Download 1eqz
  • View 1eqz
Molmil generated image of 1eqz
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE AT 2.5 A RESOLUTION
Descriptor:146 NUCLEOTIDES LONG DNA, CACODYLATE ION, CHLORIDE ION, ...
Authors:Hanson, B.L., Harp, J.M., Timm, D.E., Bunick, G.J.
Deposit date:2000-04-06
Release date:2000-04-17
Last modified:2017-10-04
Method:X-RAY DIFFRACTION (2.5 Å)
Cite:Asymmetries in the nucleosome core particle at 2.5 A resolution.
Acta Crystallogr.,Sect.D, 56, 2000
1F66
  • Download 1f66
  • View 1f66
Molmil generated image of 1f66
2.6 A CRYSTAL STRUCTURE OF A NUCLEOSOME CORE PARTICLE CONTAINING THE VARIANT HISTONE H2A.Z
Descriptor:HISTONE H2A.Z, HISTONE H2B, HISTONE H3, ...
Authors:Suto, R.K., Clarkson, M.J., Tremethick, D.J., Luger, K.
Deposit date:2000-06-20
Release date:2000-11-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.
Nat.Struct.Biol., 7, 2000
1HQ3
  • Download 1hq3
  • View 1hq3
Molmil generated image of 1hq3
CRYSTAL STRUCTURE OF THE HISTONE-CORE-OCTAMER IN KCL/PHOSPHATE
Descriptor:CHLORIDE ION, HISTONE H2A-IV, HISTONE H2B, ...
Authors:Chantalat, L., Nicholson, J.M., Lambert, S.J., Reid, A.J., Donovan, M.J., Reynolds, C.D., Wood, C.M., Baldwin, J.P.
Deposit date:2000-12-14
Release date:2001-01-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.15 Å)
Cite:Structure of the histone-core octamer in KCl/phosphate crystals at 2.15 A resolution.
Acta Crystallogr.,Sect.D, 59, 2003
1ID3
  • Download 1id3
  • View 1id3
Molmil generated image of 1id3
CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS
Descriptor:HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ...
Authors:White, C.L., Suto, R.K., Luger, K.
Deposit date:2001-04-03
Release date:2001-09-28
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3.1 Å)
Cite:Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
1KX3
  • Download 1kx3
  • View 1kx3
Molmil generated image of 1kx3
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146, AT 2.0 A RESOLUTION
Descriptor:DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
1KX4
  • Download 1kx4
  • View 1kx4
Molmil generated image of 1kx4
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP146B, AT 2.6 A RESOLUTION
Descriptor:CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.6 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
1KX5
  • Download 1kx5
  • View 1kx5
Molmil generated image of 1kx5
X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP147, AT 1.9 A RESOLUTION
Descriptor:CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ...
Authors:Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.
Deposit date:2002-01-31
Release date:2002-12-25
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.94 Å)
Cite:Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
1M18
  • Download 1m18
  • View 1m18
Molmil generated image of 1m18
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:Histone H2A.1, Histone H2B.1, Histone H3.2, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2013-07-17
Method:X-RAY DIFFRACTION (2.45 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
1M19
  • Download 1m19
  • View 1m19
Molmil generated image of 1m19
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.Mol.Biol., 326, 2003
1M1A
  • Download 1m1a
  • View 1m1a
Molmil generated image of 1m1a
LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA
Descriptor:3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ...
Authors:Suto, R.K., Edayathumangalam, R.S., White, C.L., Melander, C., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2002-06-18
Release date:2003-02-18
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.65 Å)
Cite:Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands
J.MOL.BIOL., 326, 2003
1P34
  • Download 1p34
  • View 1p34
Molmil generated image of 1p34
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3A
  • Download 1p3a
  • View 1p3a
Molmil generated image of 1p3a
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3B
  • Download 1p3b
  • View 1p3b
Molmil generated image of 1p3b
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3F
  • Download 1p3f
  • View 1p3f
Molmil generated image of 1p3f
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3G
  • Download 1p3g
  • View 1p3g
Molmil generated image of 1p3g
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3I
  • Download 1p3i
  • View 1p3i
Molmil generated image of 1p3i
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.3 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3K
  • Download 1p3k
  • View 1p3k
Molmil generated image of 1p3k
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3L
  • Download 1p3l
  • View 1p3l
Molmil generated image of 1p3l
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.4 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3M
  • Download 1p3m
  • View 1p3m
Molmil generated image of 1p3m
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.9 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3O
  • Download 1p3o
  • View 1p3o
Molmil generated image of 1p3o
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.75 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1P3P
  • Download 1p3p
  • View 1p3p
Molmil generated image of 1p3p
CRYSTALLOGRAPHIC STUDIES OF NUCLEOSOME CORE PARTICLES CONTAINING HISTONE 'SIN' MUTANTS
Descriptor:Histone H2A, Histone H2B, Histone H3, ...
Authors:Muthurajan, U.M., Bao, Y., Forsberg, L.J., Edayathumangalam, R.S., Dyer, P.N., White, C.L., Luger, K.
Deposit date:2003-04-17
Release date:2004-02-24
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
1S32
  • Download 1s32
  • View 1s32
Molmil generated image of 1s32
MOLECULAR RECOGNITION OF THE NUCLEOSOMAL 'SUPERGROOVE'
Descriptor:2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ...
Authors:Edayathumangalam, R.S., Weyermann, P., Gottesfeld, J.M., Dervan, P.B., Luger, K.
Deposit date:2004-01-12
Release date:2004-05-11
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (2.05 Å)
Cite:Molecular Recognition of the Nucleosomal 'Supergroove'
Proc.Natl.Acad.Sci.USA, 101, 2004
1TZY
  • Download 1tzy
  • View 1tzy
Molmil generated image of 1tzy
CRYSTAL STRUCTURE OF THE CORE-HISTONE OCTAMER TO 1.90 ANGSTROM RESOLUTION
Descriptor:CHLORIDE ION, HISTONE H3, HISTONE H4-VI, ...
Authors:Wood, C.M., Nicholson, J.M., Chantalat, L., Reynolds, C.D., Lambert, S.J., Baldwin, J.P.
Deposit date:2004-07-12
Release date:2004-08-03
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.9 Å)
Cite:High-resolution structure of the native histone octamer.
Acta Crystallogr.,Sect.F, 61, 2005
1U35
  • Download 1u35
  • View 1u35
Molmil generated image of 1u35
CRYSTAL STRUCTURE OF THE NUCLEOSOME CORE PARTICLE CONTAINING THE HISTONE DOMAIN OF MACROH2A
Descriptor:H2A histone family, Hist1h4i protein, Histone H3.1, ...
Authors:Chakravarthy, S., Gundimella, S.K., Caron, C., Perche, P.Y., Pehrson, J.R., Khochbin, S., Luger, K.
Deposit date:2004-07-20
Release date:2005-09-27
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (3 Å)
Cite:Structural characterization of the histone variant macroH2A.
Mol.Cell.Biol., 25, 2005
PDBj@FacebookPDBj@TwitterwwPDBwwPDB FoundationEM DataBank

Copyright © 2013-2017 Protein Data Bank Japan