+Open data
-Basic information
Entry | Database: PDB / ID: 6g63 | ||||||
---|---|---|---|---|---|---|---|
Title | RNase E in complex with sRNA RrpA | ||||||
Components |
| ||||||
Keywords | RNA BINDING PROTEIN / RNase E / small regulatory RNA | ||||||
Function / homology | Function and homology information regulation of RNA helicase activity / ribonuclease E / rRNA 5'-end processing / ribonuclease E activity / bacterial degradosome / endoribonuclease complex / DEAD/H-box RNA helicase binding / 7S RNA binding / RNA catabolic process / tRNA processing ...regulation of RNA helicase activity / ribonuclease E / rRNA 5'-end processing / ribonuclease E activity / bacterial degradosome / endoribonuclease complex / DEAD/H-box RNA helicase binding / 7S RNA binding / RNA catabolic process / tRNA processing / mRNA catabolic process / RNA nuclease activity / RNA processing / RNA endonuclease activity / cytoplasmic side of plasma membrane / rRNA processing / protein complex oligomerization / protein homotetramerization / tRNA binding / molecular adaptor activity / rRNA binding / magnesium ion binding / RNA binding / zinc ion binding / membrane / identical protein binding / cytoplasm Similarity search - Function | ||||||
Biological species | Escherichia coli (E. coli) | ||||||
Method | X-RAY DIFFRACTION / SYNCHROTRON / Resolution: 3.95 Å | ||||||
Authors | Bandyra, K.B. / Luisi, B.F. | ||||||
Funding support | United Kingdom, 1items
| ||||||
Citation | Journal: Mol. Cell / Year: 2018 Title: Substrate Recognition and Autoinhibition in the Central Ribonuclease RNase E. Authors: Bandyra, K.J. / Wandzik, J.M. / Luisi, B.F. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 6g63.cif.gz | 1.1 MB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb6g63.ent.gz | 995.6 KB | Display | PDB format |
PDBx/mmJSON format | 6g63.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/g6/6g63 ftp://data.pdbj.org/pub/pdb/validation_reports/g6/6g63 | HTTPS FTP |
---|
-Related structure data
-Links
-Assembly
Deposited unit |
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-Components
#1: Protein | Mass: 57495.465 Da / Num. of mol.: 4 / Mutation: D303R,D346R Source method: isolated from a genetically manipulated source Source: (gene. exp.) Escherichia coli (strain K12) (bacteria) Gene: rne, ams, hmp1, b1084, JW1071 / Production host: Escherichia coli (E. coli) / References: UniProt: P21513, ribonuclease E #2: RNA chain | | Mass: 8057.715 Da / Num. of mol.: 1 Source method: isolated from a genetically manipulated source Details: Because of the low resolution, we modelled the RNA structure as two chains in a duplex of polyU:polyA. The sequence of the RNA used in the crystal is ...Details: Because of the low resolution, we modelled the RNA structure as two chains in a duplex of polyU:polyA. The sequence of the RNA used in the crystal is ACGGUUAUAAAUCAACACAUUGAUUUAUAAGCAUGGAAAUCCCCUGAGUGAAACAACGAAUUGCUGUGUGUAGUCUUUGCCCGUCUCCUACGAUGGGCUUUUUUUU Source: (gene. exp.) Escherichia coli (E. coli) / Production host: Escherichia coli (E. coli) #3: Chemical | #4: Chemical | ChemComp-U / | |
---|
-Experimental details
-Experiment
Experiment | Method: X-RAY DIFFRACTION / Number of used crystals: 1 |
---|
-Sample preparation
Crystal | Density Matthews: 3.51 Å3/Da / Density % sol: 64.92 % |
---|---|
Crystal grow | Temperature: 293 K / Method: vapor diffusion, sitting drop / pH: 8.5 Details: 0.1 M KCl, 0.01 M MgCl2, 0.05 M Tris-HCl pH 8.5 and 30% (v/v) PEG 400 |
-Data collection
Diffraction | Mean temperature: 100 K |
---|---|
Diffraction source | Source: SYNCHROTRON / Site: SOLEIL / Beamline: PROXIMA 2 / Wavelength: 0.987 Å |
Detector | Type: DECTRIS EIGER R 4M / Detector: PIXEL / Date: Oct 1, 2016 |
Radiation | Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray |
Radiation wavelength | Wavelength: 0.987 Å / Relative weight: 1 |
Reflection | Resolution: 3.95→95.8 Å / Num. obs: 28217 / % possible obs: 100 % / Redundancy: 9.6 % / Rmerge(I) obs: 0.15 / Net I/σ(I): 8.3 |
Reflection shell | Resolution: 3.95→4.19 Å |
-Processing
Software |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Resolution: 3.95→19.947 Å / SU ML: 0.66 / Cross valid method: FREE R-VALUE / σ(F): 1.39 / Phase error: 32.82 / Stereochemistry target values: ML
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: LAST / Resolution: 3.95→19.947 Å
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
LS refinement shell |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Refine-ID: X-RAY DIFFRACTION
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|