[English] 日本語
Yorodumi- PDB-5e3m: Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTC... -
+Open data
-Basic information
Entry | Database: PDB / ID: 5e3m | ||||||
---|---|---|---|---|---|---|---|
Title | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | ||||||
Components |
| ||||||
Keywords | DNA BINDING PROTEIN/DNA / Protein-DNA complex / HTH domain / minor groove compression / DNA bending / indirect recognition / DNA BINDING PROTEIN-DNA complex | ||||||
Function / homology | Function and homology information invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex ...invertasome / positive regulation of DNA recombination / sequence-specific DNA binding, bending / provirus excision / nucleoid / DNA-binding transcription repressor activity / DNA-binding transcription activator activity / chromosome organization / core promoter sequence-specific DNA binding / protein-DNA complex / response to radiation / nucleosome / sequence-specific DNA binding / transcription cis-regulatory region binding / DNA-templated transcription / regulation of DNA-templated transcription / protein homodimerization activity / DNA binding / cytosol Similarity search - Function | ||||||
Biological species | Escherichia coli (E. coli) synthetic construct (others) | ||||||
Method | X-RAY DIFFRACTION / SYNCHROTRON / MOLECULAR REPLACEMENT / molecular replacement / Resolution: 2.886 Å | ||||||
Authors | Stella, S. / Hancock, S.P. / Cascio, D. / Johnson, R.C. | ||||||
Funding support | United States, 1items
| ||||||
Citation | Journal: Plos One / Year: 2016 Title: DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Authors: Hancock, S.P. / Stella, S. / Cascio, D. / Johnson, R.C. | ||||||
History |
|
-Structure visualization
Structure viewer | Molecule: MolmilJmol/JSmol |
---|
-Downloads & links
-Download
PDBx/mmCIF format | 5e3m.cif.gz | 140.6 KB | Display | PDBx/mmCIF format |
---|---|---|---|---|
PDB format | pdb5e3m.ent.gz | 113.8 KB | Display | PDB format |
PDBx/mmJSON format | 5e3m.json.gz | Tree view | PDBx/mmJSON format | |
Others | Other downloads |
-Validation report
Arichive directory | https://data.pdbj.org/pub/pdb/validation_reports/e3/5e3m ftp://data.pdbj.org/pub/pdb/validation_reports/e3/5e3m | HTTPS FTP |
---|
-Related structure data
-Links
-Assembly
Deposited unit |
| ||||||||
---|---|---|---|---|---|---|---|---|---|
1 |
| ||||||||
Unit cell |
|
-Components
#1: Protein | Mass: 11252.918 Da / Num. of mol.: 2 Source method: isolated from a genetically manipulated source Source: (gene. exp.) Escherichia coli (E. coli) / Strain: K12 / Gene: fis, b3261, JW3229 / Plasmid: pET11a / Production host: Escherichia coli (E. coli) / Strain (production host): BL21(DE3) / References: UniProt: P0A6R3 #2: DNA chain | | Mass: 8304.393 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #3: DNA chain | | Mass: 8282.397 Da / Num. of mol.: 1 / Source method: obtained synthetically / Source: (synth.) synthetic construct (others) #4: Water | ChemComp-HOH / | |
---|
-Experimental details
-Experiment
Experiment | Method: X-RAY DIFFRACTION / Number of used crystals: 1 |
---|
-Sample preparation
Crystal | Density Matthews: 4.06 Å3/Da / Density % sol: 69.68 % |
---|---|
Crystal grow | Temperature: 277 K / Method: vapor diffusion, hanging drop / pH: 8.5 Details: 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
-Data collection
Diffraction | Mean temperature: 100 K | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction source | Source: SYNCHROTRON / Site: ALS / Beamline: 8.2.2 / Wavelength: 1 Å | |||||||||||||||||||||||||||
Detector | Type: ADSC QUANTUM 315 / Detector: CCD / Date: Mar 5, 2007 | |||||||||||||||||||||||||||
Radiation | Monochromator: Si (111) / Protocol: SINGLE WAVELENGTH / Monochromatic (M) / Laue (L): M / Scattering type: x-ray | |||||||||||||||||||||||||||
Radiation wavelength | Wavelength: 1 Å / Relative weight: 1 | |||||||||||||||||||||||||||
Reflection | Resolution: 2.88→40.412 Å / Num. obs: 13581 / % possible obs: 94.4 % / Redundancy: 6.6 % / Biso Wilson estimate: 35.76 Å2 / CC1/2: 0.998 / Rmerge(I) obs: 0.082 / Rpim(I) all: 0.034 / Net I/σ(I): 13.7 / Num. measured all: 89910 | |||||||||||||||||||||||||||
Reflection shell | Diffraction-ID: 1 / Rejects: 0
|
-Phasing
Phasing | Method: molecular replacement |
---|
-Processing
Software |
| ||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Refinement | Method to determine structure: MOLECULAR REPLACEMENT / Resolution: 2.886→40.412 Å / SU ML: 0.35 / Cross valid method: FREE R-VALUE / σ(F): 1.34 / Phase error: 20.91 / Stereochemistry target values: ML
| ||||||||||||||||||||||||||||||||||||||||||
Solvent computation | Shrinkage radii: 0.9 Å / VDW probe radii: 1.11 Å / Solvent model: FLAT BULK SOLVENT MODEL | ||||||||||||||||||||||||||||||||||||||||||
Displacement parameters | Biso max: 163.29 Å2 / Biso mean: 43.4773 Å2 / Biso min: 8.38 Å2 | ||||||||||||||||||||||||||||||||||||||||||
Refinement step | Cycle: final / Resolution: 2.886→40.412 Å
| ||||||||||||||||||||||||||||||||||||||||||
Refine LS restraints |
| ||||||||||||||||||||||||||||||||||||||||||
LS refinement shell | Refine-ID: X-RAY DIFFRACTION / Total num. of bins used: 5
| ||||||||||||||||||||||||||||||||||||||||||
Refinement TLS params. | Method: refined / Origin x: 32.5154 Å / Origin y: -10.9848 Å / Origin z: 20.7565 Å
| ||||||||||||||||||||||||||||||||||||||||||
Refinement TLS group |
|