3D Electron Microscopy (3D-EM) Data Navigator [English / [日本語]]
Top Gallery List Statistics Shape search Viewer
Movie pageYodrodumi (structure viewer)
PDBj>EM Navigator>Detail page - EMDB-1271

This page is a legacy version and will be discarded in future. The new page is here.

Structural model of full-length human Ku70-Ku80 heterodimer and its recognition of DNA and DNA-PKcs.

by single particle reconstruction, at 25 A resolution

Movie

Orientation:

#1: Surface view with section colored by density value, Surface level: 2.371905906, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 2.371905906, Imaged by UCSF CHIMERA

Entry
Summary
Database / IDEM DATA BANK (EMDB) / 1271
TitleStructural model of full-length human Ku70-Ku80 heterodimer and its recognition of DNA and DNA-PKcs.
MapFrontal view of the Ku+DNA volume at a thresold of 2.5
SampleKu70-Ku80 heterodimer purified from HeLa cell nuclear extracts bound to DNA
AuthorsRivera-Calzada A, Spagnolo L, Pearl LH, Llorca O
DateDeposition: 2006-10-03, Header release: 2006-10-03, Map release: 2006-10-03, Last update: 2011-05-26
EMDB SitesEMDB @PDBe (EU), EMDB @RCSB (USA)
Structure Visualization
MoviesMovie Page

#1: Surface view with section colored by density value, Surface level: 2.371905906, Imaged by UCSF CHIMERA

#2: Surface view colored by radius, Surface level: 2.371905906, Imaged by UCSF CHIMERA

Supplemental images
Structure viewersYorodumi, Launch PeppeR (About PeppeR), Volume viewer (RCSB, PDBe)
Related Structure Data
Related Entries

Cite: data citing same article

Similar-shape strucutres
Search for similar-shape assemblies throgh:
EMDB + EM entries in PDB
all of EMDB & PDB (Omokage search)
Article
Citation - Primary
ArticleEMBO Rep., Vol. 8, Issue 1, Page 56-62, Year 2007
TitleStructural model of full-length human Ku70-Ku80 heterodimer and its recognition of DNA and DNA-PKcs.
AuthorsAngel Rivera-Calzada, Laura Spagnolo, Laurence H Pearl, Oscar Llorca
Centro de Investigaciones Biológicas (CIB), Spanish National Research Council (CSIC), Ramiro de Maeztu 9, Campus Complutense University, Madrid 28040, Spain.
KeywordsAntigens, Nuclear (chemistry), DNA (chemistry, 9007-49-2), DNA-Activated Protein Kinase (chemistry, 2.7.11.1), DNA-Binding Proteins (chemistry), Dimerization, Humans, Ku Autoantigen (4.2.99.-), Microscopy, Electron, Protein Conformation, Protein Interaction Mapping, Xrcc6 protein, human (3.6.4.12)
LinksPubMed: 17159921, DOI: 10.1038/sj.embor.7400847, PMC: PMC1796749
Map
Fileemd_1271.map.gz ( map file in CCP4 format, 3457 KB )
Projections & SlicesSize of images:
AxesZ (Sec.)Y (Row.)X (Col.)
96 pix
2.12 A/pix
= 203.52 A
96 pix
2.12 A/pix
= 203.52 A
96 pix
2.12 A/pix
= 203.52 A

Surface

Projections

Slices (1/3)

Slices (1/2)

Slices (2/3)

Images are generated by Spider package.

Density
Contour Level:1.14, 2.3719059 (movie #1):
Minimum - Maximum: -2.33323 - 13.3996
Average (Standard dev.): 0.206044 (1.0865)
Data TypeImage stored as Reals
Space Group Number1
Map Geometry
Axis orderXYZ
Dimensions969696
Origin-48-48-48
Limit474747
Spacing969696
Unit CellA= B= C: 203.52 A
Alpha=beta=gamma: 90 degrees
Pixel SpacingX= Y= Z: 2.12 A
CCP4 map header info
modeImage stored as Reals
A/pix X/Y/Z2.122.122.12
M x/y/z969696
origin x/y/z0.0000.0000.000
length x/y/z203.520203.520203.520
alpha/beta/gamma90.00090.00090.000
start NX/NY/NZ-184-184-183
NX/NY/NZ368368368
MAP C/R/S123
start NC/NR/NS-48-48-48
NC/NR/NS969696
start NC,NX/NR,NY/NS,NZ
NC,NX/NR,NY/NS,NZ
D min/max/mean-2.33313.4000.206
Annotation DetailsFrontal view of the Ku+DNA volume at a thresold of 2.5
Supplement
Images
Images
Sample
NameKu70-Ku80 heterodimer purified from HeLa cell nuclear extracts bound to DNA
Oligomeric StateHeterodimer of Ku70 and Ku80 complexed bound to DNA
Number of Components3
Experimental Mass0.152MDa
Component #1: protein - Ku70
Scientific nameKu70
Experimental Mass0.07 MDa
Number of Copies1
Scientific Name of SpeciesHomo sapiens
Common Name of SpeciesHuman
NCBI taxonomy9606
Recombinant expressionNo
Natural SourceOrganelle: Nucleus
Cell: HeLa
LinksGene Ontology: GO:0005624, Inter Pro: IPR:006164
Component #2: protein - Ku80
Scientific nameKu80
Experimental Mass0.082 MDa
Number of Copies1
Scientific Name of SpeciesHomo sapiens
Common Name of SpeciesHuman
NCBI taxonomy9606
Recombinant expressionNo
Natural SourceCell: HeLa
Organelle: Nucleus
LinksInter Pro: IPR:006164, Gene Ontology: GO:0005634
Component #3: nucleic-acid - DNA
Scientific nameDNA
Details54 bp blunt-ended dsDNA 5' biotinilated
SequenceGGCCGCACGCGTCCACCATGGGGTACAACTACGATCTAGCTTCATGCACC GGAC
ClassDNA
StructureDOUBLE HELIX
SyntheticYes
Experiment
Sample Preparation
Specimen Conc0.068 mg/ml
StainingA few microliters of the DNA-bound Ku complexes were adsorbed to glow discharged carbon coated grids and negatively stained using 1% uranyl acetate.
Specimen Support Details400 mesh Copper/Palladium grid
Specimen Stateparticle
BufferDetails: 50 mM Tris pH 7.5, 10% glycerol, 1mM DTT, 5 mM EDTA, 0.5mM Mg2Cl, 100mM NaCl, 20mM KCl
Vitrification
Cryogen NameNONE
Imaging
MicroscopeJEOL 1230
Date2005-04-20
DetailsMicroscope used: JEOL1230
Electron Gun
Electron SourceTUNGSTEN HAIRPIN
Accelerating Voltage100 kV
Illumination ModeFLOOD BEAM
Lens
MagnificationNominal: 50000
Astigmatismcorrection with FFT and CCD camera
Nominal Cs2.9 mm
Imaging ModeBRIGHT FIELD
Specimen Holder
HolderEucentric
ModelOTHER
Tilt Angle0 degrees - 35 degrees
Camera
DetectorKODAK 4489 FILM
Image Acquisition
#1
Sampling Size10
Quant Bit Number16
ScannerOTHER
DetailsScanner: MINOLTA Dimage Scan Multi Pro scanner
Processing
Methodsingle particle reconstruction
3D reconstruction
SoftwareEMAN
Resolution By Author25 A
Resolution MethodFSC 0.5
Single Particle
Number of Projections8285
DetailsPurified Ku and a ~10- fold molar excess of DNA were incubated at room temperature for 20 minutes.
Applied SymmetryC1 (asymmetric)
Atomic Model Fitting
Model #0
Refinement Protocolrigid body
Target CriteriaR-factor
SoftwareSitus
DetailsProtocol: Rigid Body. Fitting performed using Situs
PDB Entry ID1JEY
Download
Data from EMDB
Header (meta data in XML format)emd-1271.xml (8.9 KB)
Map dataemd_1271.map.gz (606.6 KB)
Images1271.gif (44 KB)
FTP directoryftp://ftp.pdbj.org/pub/emdb/structures/EMD-1271
Movie files
movie #1
.mp4 (H.264/MPEG-4 AVC format), 3.6 MB
.webm (WebM/VP8 format), 5.4 MB
Session file for UCSF-Chimera, 20.1 KB
movie #2
.mp4 (H.264/MPEG-4 AVC format), 3.3 MB
.webm (WebM/VP8 format), 4.7 MB
Session file for UCSF-Chimera, 20.2 KB